sacT

sacT
168

transcriptional antiterminator for the [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA] operon

locus
BSU_38070
Molecular weight
31.92 kDa
pI
5.59
Protein length
Gene length
function
regulation of sucrose utilization
product
transcriptional antiterminator
essential
no
synonyms
sacT, ipa-47d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3711 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,906,142  3,906,972
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
binding to the mRNA of the ''[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'' operon, causes transcription antitermination (in presence of sucrose and absence of glucose)
Protein family
[wiki|PRD-containing transcription factors]
[wiki|Domains]
N-terminal RNA binding domain [Pubmed|10610766]
2 x [wiki|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] regulation domains) [Pubmed|9663674]
2 [wiki|PRD] domains (aa 62-167, aa 168-276) (according to UniProt)
Structure
[PDB|1TLV] (the [wiki|PRD] domains of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT], corresponds to aa 54 ... 271, 41% identity) [pubmed|15699035]
[AF|P26212]
Modification
Phosphorylated and inactivated by [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP] (EIIScr) (according to Swiss-Prot)
Paralogous protein(s)
[protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY], [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]
Expression and Regulation
Operons
genes
[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
description
[Pubmed|9353933]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [Pubmed|26020636], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
Open in new tab

[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]

2024-07-09 01:10:57

ghost

49

00eff526603e3225d0ab9cd02e923620d0256c31

4422109CE2B2DA9ADEBFCAFA7447BB0EA1C7E326

genes
[gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]-[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
description
[Pubmed|22383849]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [Pubmed|26020636], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]→[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]

2024-07-15 03:29:13

Bzhu

69

8f5ad01051d694117dfacb8fa885cc9474caa2d9

B449BD6006CAB5993C58240A8A1A7B4ED902F5A7

Biological materials
Mutant
GP429 (spc), available in [wiki|Jörg Stülke]'s lab
BKE38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC,  downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
BKK38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC,  downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
Expression vectors
for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP166, available in [wiki|Jörg Stülke]'s lab
for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP426, available in [wiki|Jörg Stülke]'s lab
for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP427, available in [wiki|Jörg Stülke]'s lab
for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [wiki|pGP570]: pGP439, available in [wiki|Jörg Stülke]'s lab
for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [wiki|pGP570]: pGP440, available in [wiki|Jörg Stülke]'s lab
for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [wiki|pGP570]: pGP571, available in [wiki|Jörg Stülke]'s lab
for expression of RNA-binding domain in ''B. subtilis'', in [wiki|pBQ200]: pGP446, available in [wiki|Jörg Stülke]'s lab
for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with C-terminal Strep-tag, in [wiki|pGP382]: pGP1064, available in [wiki|Jörg Stülke]'s lab
for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with N-terminal Strep-tag, in [wiki|pGP380]: pGP1068, available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1223 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1227 (spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
9663674,18086213
Original Publications
12107147,2163394,1577686,8702561,1279678,21278164,26020636,22383849,15699035

6796E1C147AA21E919A42A953884DC24E182F430

Page visits: 3555

Time of last update: 2024-07-14 21:06:32

Author of last update: Melvin.boenninger