yybS

yybS
168

unknown

locus
BSU_40520
Molecular weight
34.38 kDa
pI
9.95
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yybS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4241 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,165,659  4,166,588
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[AF|P37485]
Expression and Regulation
Operons
genes
[gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]-[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]-[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
description
[Pubmed|22383849]
additional information
term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yybS'' [Pubmed|27120414]
there is an [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-dependent antisense RNA ([gene|0098E3A710385B31987947E6206A89000CA32F55|S1559]) to [gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [pubmed|22956758]
Open in new tab

[gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]→[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]

2024-07-06 23:23:04

Jstuelk

98

5C9AFECBF28951E728207E104CAD078590852270

8A05783D8D0BA185AE37B5649C8B5E3E55F05A22

Biological materials
Mutant
MGNA-B835 (yybS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1834 NBRP B. subtilis, Japan]
BKE40520 ([gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTAGTCACCTCGTATCA,  downstream forward: _UP4_TGAACATGAGTTTTACTCAC
BKK40520 ([gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTAGTCACCTCGTATCA,  downstream forward: _UP4_TGAACATGAGTTTTACTCAC
References
20525796,27120414

6640C754249DD8E4E15889CC838F5D04A682BF58

Page visits: 1992

Time of last update: 2024-07-15 01:19:31

Author of last update: Bzhu