ylbH

ylbH
168

predicted methyltransferase, 16S rRNA (G966) methyltransferase

locus
BSU_15010
Molecular weight
18.14 kDa
pI
6.51
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ylbH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0742 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,569,519 → 1,570,073
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[PDB|2FHP] (from Enterococcus faecalis, 48% identity)
[AF|O34331]
Expression and Regulation
Operons
genes
[gene|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[gene|FBD8F0EB241A35747E6398C9AA30D71D6D17CE99|ylbG]-[gene|65FA4B3738C2A5995F019099743C782ADD15C338|ylbH]-[gene|6DAAEF20B68139A732FDCDABD0C420A0C928D373|coaD]
description
[Pubmed|22383849]
Open in new tab

[gene|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]→[gene|6DAAEF20B68139A732FDCDABD0C420A0C928D373|coaD]

2024-06-02 18:52:06

Jstuelk

92

2162b14729468342cf42886fefd68855b3668199

79BDA992AAE4BACCDAC85A63130F2F758FA7CD65

genes
[gene|65FA4B3738C2A5995F019099743C782ADD15C338|ylbH]-[gene|6DAAEF20B68139A732FDCDABD0C420A0C928D373|coaD]
description
[Pubmed|22383849]
Open in new tab

[gene|65FA4B3738C2A5995F019099743C782ADD15C338|ylbH]→[gene|6DAAEF20B68139A732FDCDABD0C420A0C928D373|coaD]

2024-07-03 08:55:02

Jstuelk

55

07cfcfa6c3a356e276f05163072e3f05363f63e9

A01DD00CDBDBB0704F709938320D0F931D1F33A4

Biological materials
Mutant
MGNA-B244 (ylbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1243 NBRP B. subtilis, Japan]
BKE15010 (Δ[gene|65FA4B3738C2A5995F019099743C782ADD15C338|ylbH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCACACCACTTTTT,  downstream forward: _UP4_ATTTATAAAAAGAGGGGGTA
BKK15010 (Δ[gene|65FA4B3738C2A5995F019099743C782ADD15C338|ylbH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCACACCACTTTTT,  downstream forward: _UP4_ATTTATAAAAAGAGGGGGTA
References
17189261

65FA4B3738C2A5995F019099743C782ADD15C338

Page visits: 1683

Time of last update: 2024-07-15 06:50:50

Author of last update: Jstuelk