pnpA

pnpA
168

polynucleotide phosphorylase, RNase, contributes to efficient 3' exonucleolytic mRNA decay (together with [protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]), involved in double-strand break repair

locus
BSU_16690
Molecular weight
77.28 kDa
pI
4.89
Protein length
Gene length
function
DNA repair, competence development, RNA degradation
product
polynucleotide phosphorylase (PNPase)
essential
no
ec
2.7.7.8
synonyms
pnpA, comR, pnp

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1185 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,739,383 1,741,500
Phenotypes of a mutant
The [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant is cold sensitive and sensitive to tetracyclin, it shows multiseptate filamentous growth [Pubmed|8636041]
The mutant is deficient in genetic competence (no expression of the late competence genes) [Pubmed|8825779]
The [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant exhibits reduced motility and reduced expression of the [wiki|fla-che operon] resulting from accumulation of [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] mRNA [Pubmed|26857544]
The mutant overexpresses the ''trp'' and ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]'' operons
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
3'-5' exoribonuclease, [wiki|RNase]
PNPase degrades the trp mRNA from RNA-TRAP complex
degradation of the [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] mRNA from the 3' end, through the [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]-dependent terminator [Pubmed|26857544]
involved in double-strand break (DSB) repair via homologous recombination (HR) or non-homologous end-joining (NHEJ) [Pubmed|21859751]
degrades ssDNA (3' - 5') (stimulated by [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA], inhibited by [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]) [Pubmed|21859751]
can polymerize ssDNA at a free 3' OH end, stimulated by [protein|5680A06A74D3EC6310EF8677795511C75DB3059E|recN] [Pubmed|21859751]
phosphate + RNA(n+1) --> ribonucleoside 5'-diphosphate + RNA(n) (according to UniProt)
Protein family
polyribonucleotide nucleotidyltransferase family (single member, according to UniProt)
[wiki|Domains]
[wiki|KH domain] (aa 554-613) (according to UniProt)
[wiki|S1 domain] (aa 623-691) (according to UniProt)
Structure
[PDB|5YJJ] (protein from ''Staphylococcus aureus'') [pubmed|29242153]
[PDB|3GCM] (protein from ''E. coli'', PNPase/RNase E micro-domain/RNA tetragonal crystal form )
[AF|P50849]
[wiki|Localization]
cytoplasm (homogeneous) [Pubmed|27708634]
Additional information
required for the expression of late competence genes [gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA] and [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK], requirement bypassed by a [gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA] disruption; may be necessary for modification of the [gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA] transcript (stabilization or translation activation)
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]
description
[pubmed|22383849]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
Open in new tab

[gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]

2024-05-23 02:36:17

Bzhu

79

daa77da512a62a4fa8ec7e9a620dbf5ab02f2ef9

0B0CC74CB236CC01C1FBD863763EFC1EDE826024

Biological materials
Mutant
GP1748 (Δ[gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]::aphA3), available in [wiki|Jörg Stülke]'s lab, [Pubmed|27708634]
BKE16690 ([gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA
BKK16690 ([gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA
Expression vectors
for expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP838, available in [wiki|Jrg Stlke]'s lab
for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [wiki|SPINE], in [wiki|pGP380]: pGP1342, available in [wiki|Jrg Stlke]'s lab
for chromosomal expression of PnpA-Strep (cat): GP1002, available in [wiki|Jrg Stlke]'s lab
for chromosomal expression of PnpA-Strep (spc): GP1038, available in [wiki|Jrg Stlke]'s lab
pGP1439: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jrg Stlke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab, [pubmed|19193632]
FLAG-tag construct
GP1021 (spc, based on [wiki|pGP1331]) [Pubmed|21803996], available in [wiki|Jrg Stlke]'s lab
GP1076 (ermC) [Pubmed|21803996], available in [wiki|Jrg Stlke]'s lab
GFP fusion
GP1698 (in [wiki|pBP43]), expression of '' pnpA-GFP''::''spc'' under the native promoter, available in [wiki|Jrg Stlke]'s lab [Pubmed|27708634]
labs
[wiki|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers Laboratories and Programs/Bechhofer Laboratory?citype=Physician&ciid=Bechhofer David H 1255565 Homepage]
References
Reviews
10087930,19215773,17514363,16733069,22568516,25155548,25292357,25878039,28117687,29651979,30340785,31464530
Original Publications
11948165,10572137,8825779,19433509,9811656,14976255,15995184,8825778,8636041,15805522,19193632,1707536,19633085,19638340,20360175,20418391,20572937,21803996,21862575,22198292,23529473,21859751,15378759,25099370,26797123,26857544,27708634,28238534,28334892,28516784,29242153,31041723,33323028,34096591,34417617,35311531,35638827,37994189
PNPase in ''E. coli
19327365,21324911,18650428

64C6D783FF3F41C81B216F798A1DC8071345B1ED

Page visits: 7246

Time of last update: 2024-05-23 10:53:33

Author of last update: Jstuelk