rsbR

rsbR
168

[wiki|stressosome] sensor protein, control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB] activity

locus
BSU_04670
Molecular weight
30.90 kDa
pI
4.73
Protein length
Gene length
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB] activity
product
activator of [protein|search|RsbT ]kinase activity, [wiki|stressosome] sensor protein
essential
no
synonyms
rsbR, ycxR, rsbRA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1366 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
519,408 520,232
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
positive regulator of [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]-dependent light activation of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB] stress response [Pubmed|22287516]
phosphorylated [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR] activates the kinase activity of [protein|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT] [Pubmed|23320651]
[wiki|Domains]
RsbRA is composed of an N-terminal nonheme globin domain and a highly conserved C-terminal STAS (Sulphate Transporter and AntiSigma factor antagonist) domain. The C-terminal STAS domain is the target of the serine/threonine-specific kinase [protein|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT] (see below).
[wiki|STAS domain] (aa 150-265) (according to UniProt)
Structure
[PDB|2BNL] (N-terminal domain), [PDB|3VY9] (complete stressosome)
[AF|P42409]
Modification
phosphorylation on Thr-171 and Thr-205 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT] [Pubmed|21362065]
Paralogous protein(s)
[protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|rsbRD], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
description
[Pubmed|8002610]
regulation
''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|20454630], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8002610], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]→[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]

2024-05-21 06:50:23

ghost

115

5f220975cc2493224a8aa0770ee2187c815a2127

3EFC8DC1AC54632D4F2AC30497749AB5CCA3A39F

Biological materials
Mutant
BKE04670 ([gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCGCTTACCTCCCAA, downstream forward: _UP4_ATCGTTTCATTGGGGGAATA
BKK04670 ([gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCGCTTACCTCCCAA, downstream forward: _UP4_ATCGTTTCATTGGGGGAATA
labs
[wiki|Bill Haldenwang], San Antonio, USA
[wiki|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
[wiki|Rick Lewis], Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/r.lewis homepage]
References
Reviews
19704888,16319496,20658979,23416074,28271471,33042030
Original Publications
36815589,8002610,8682769,8682789,17726680,10781545,15583165,8824586,10329124,17158665,9179850,8808936,15312768,11244072,15342582,15378759,12950928,15466036,9179850,8955331,18832644,17726680,17218307,20019076,21602359,23320651,21362065,20935101,22287516,22609918,24599254,28727759,33287544,36409125,38236030

621357D1FB6AC1B0499732EFE226F982B26CE34E

Page visits: 4500

Time of last update: 2024-05-23 13:14:29

Author of last update: Jstuelk