gndA

gndA
168

NADP-dependent phosphogluconate dehydrogenase

locus
BSU_23860
Molecular weight
51.61 kDa
pI
5.08
Protein length
Gene length
function
pentose phosphate pathway
product
NADP-dependent phosphogluconate dehydrogenase
essential
no
ec
1.1.1.44
synonyms
gndA, yqjI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0362 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,480,750 2,482,159
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
6-phospho-D-gluconate + NADP+ --> CO2 + D-ribulose 5-phosphate + NADPH (according to UniProt)
Protein family
6-phosphogluconate dehydrogenase family (with [protein|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|yqeC] and [protein|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ], according to UniProt)
Structure
[PDB|2W8Z] (from ''Geobacillus stearothermophilus'', 83% identity, 92% similarity) [Pubmed|19407374]
[AF|P80859]
Modification
phosphorylation on (Thr-15 OR Thr-17) [Pubmed|17218307]
Effectors of protein activity
inhibited by 4-phosphoerythronate (results from oxidation of erythrose-4-phosphate) [pubmed|30948730]
Kinetic information
Reversible reaction [Pubmed|15231785]
Paralogous protein(s)
[protein|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
Additional information
It contains a cysteine on the active site. The enzyme is a dimer. [Pubmed|15231785]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]
description
[pubmed|22383849]
Open in new tab

[gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]

2024-05-21 19:39:20

Jstuelk

51

95401f88c699f1568c284e161c6e78f59b4fa3db

208B95053B22069BF9C0E4E4BD18072A81E37811

genes
[gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]-[gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]
description
[pubmed|22383849]
regulation
constitutively expressed [Pubmed|15469515]
Open in new tab

[gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]→[gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]

2024-05-21 21:38:35

Jstuelk

61

0ab6586973869a31966395fe1150bbd523f0e616

DDC038A113D7CE7BB6CF11557454A59E525E06B8

Biological materials
Mutant
MGNA-C391 (yqjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2389 NBRP B. subtilis, Japan]
GP1514 (''gndA''::''kan''), available in [wiki|Jrg Stlke]'s lab
BKE23860 ([gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA
BKK23860 ([gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA
Expression vectors
pGP1777 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jrg Stlke]'s lab)
pGP1789 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP1389]) (available in [wiki|Jrg Stlke]'s lab)
GP1408 (''gndA''-''Strep'' ''(spc)'') & GP1410 (''gndA''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [wiki|SPINE], available in [wiki|Jrg Stlke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
FLAG-tag construct
GP1403 (spc, based on [wiki|pGP1331]), available in [wiki|Jrg Stlke]'s lab
GP1408 (kan, resistance cassette exchange in GP1403), available in [wiki|Jrg Stlke]'s lab
References
17218307,19407374,15378759,15231785,26883633,30948730,36815589

61B7C51EB7E74226890010B61D8E41C02189A453

Page visits: 6686

Time of last update: 2024-05-23 02:41:27

Author of last update: Jstuelk