sodA

sodA
168

superoxide dismutase, general stress protein, important for survival of ethanol and paraquat stresses and at low temperatures

locus
BSU_25020
Molecular weight
22.43 kDa
pI
5.2
Protein length
Gene length
function
detoxification of oxygen radicals
product
superoxide dismutase
essential
no
ec
1.15.1.1
synonyms
sodA, yqgD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0605 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,585,434 2,586,042
Phenotypes of a mutant
a [gene|913D6DA06785C3AD0C89D77D48831518C6663387|yqgC] [protein|6153A07B961017052E1072944B59F510D80CEC0F|sodA] double mutant is hypersensitive to [metabolite|Mn(2+)], due to reduced expression of [metabolite|Mn(2+)] exporters [protein|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP] and [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS] and intracellular [metabolite|Mn(2+)] accumulation [pubmed|38819154]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
2 H+ + 2 [metabolite|superoxide] --> H2O2 + O2 (according to UniProt)
Protein family
iron/manganese superoxide dismutase family (with [protein|E0645DD4A7A871457300139A7E5986EF11C07387|sodF], according to UniProt)
[wiki|Cofactors]
[metabolite|Mn(2+)]
Structure
[PDB|2RCV] [Pubmed|18084079]
[AF|P54375]
Modification
phosphorylation on Thr-34 AND Thr-70 [Pubmed|17218307]
Paralogous protein(s)
[protein|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]
[wiki|Localization]
cytoplasm [Pubmed|22174384]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|913D6DA06785C3AD0C89D77D48831518C6663387|yqgC]-[gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]
description
[Pubmed|22383849]
Open in new tab

[gene|913D6DA06785C3AD0C89D77D48831518C6663387|yqgC]→[gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]

2024-07-10 01:06:21

Jstuelk

57

a1567cd80fca0ccffe0f308095001245da4e04e3

63064BBB40CD70B88FE79FEAAB5631AC64F91D40

genes
[gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]
description
[pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
constitutive expression [Pubmed|22174384]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]

2024-07-07 10:06:17

Bzhu

57

f80f95249a7709407d7042f384fbbe7c0912c316

EC8C3530B04FC1AE04A1A1CC13E82A90F106778B

Biological materials
Mutant
GP3165 [gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]::spec trpC2 available in [wiki|Jrg Stlke]'s lab
MGNA-C451 (yqgD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2449 NBRP B. subtilis, Japan]
BKE25020 ([gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATTCCTCCTTAGT, downstream forward: _UP4_TAATGGCACAAACAAGGTCC
BKK25020 ([gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATTCCTCCTTAGT, downstream forward: _UP4_TAATGGCACAAACAAGGTCC
References
9393707,9573176,20525796,15805528,17218307,9658017,10074093,22174384,22582280,15378759,18084079,38819154

6153A07B961017052E1072944B59F510D80CEC0F

Page visits: 7117

Time of last update: 2024-07-15 05:10:31

Author of last update: Jstuelk