

similar to ribosomal-protein-alanine N-acetyltransferase

Molecular weight
20.78 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1670 (Galperin et al., 2021)

This gene is a member of the following regulons

1,260,811  1,261,356
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
acetyl-CoA + N-terminal L-alanyl-[ribosomal protein uS5] --> CoA + H+ + N-terminal Nα-acetyl-L-alanyl-[ribosomal protein uS5] (according to UniProt)
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|N-acetyltransferase domain] (aa 7-172) (according to UniProt)
[PDB|3IGR] (from Vibrio fischeri, 35% identity)
Paralogous protein(s)
[protein|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB], (30.3%)
cytoplasm (Homogeneous) [Pubmed|16479537]
Expression and Regulation
expression is increased upon depletion of depletion of tRNA maturation factors [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB] or [gene|C40C5D35ED53D343C8200248FCCB010BAB388054|rnz] [pubmed|36840557]
Open in new tab


2024-06-06 02:17:21





Biological materials
MGNA-B257 (yjcK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1256 NBRP B. subtilis, Japan]
GP1246 (''yjcK''::''cat''), available in [wiki|Jörg Stülke]'s lab
GP1255 (''[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]''::''kan'' ''[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''cat'' ''[gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]''::''spec'' ''[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]''::''tet''), available in [wiki|Jörg Stülke]'s lab
BP139 (''[gene|470824F73C8C9CF0519C1E536DBF19D8A93723CE|yjcL]-[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''ermC''), available in [wiki|Fabian Commichau]'s lab
BKE11890 ([gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAGTGATCTCTCCGTT,  downstream forward: _UP4_TAATAAAAGAAGCCGGACTA
BKK11890 ([gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAGTGATCTCTCCGTT,  downstream forward: _UP4_TAATAAAAGAAGCCGGACTA


Page visits: 1885

Time of last update: 2024-06-12 09:41:15

Author of last update: Jstuelk