panG

panG
168

[metabolite|alpha-ketopantoate] reductase

locus
BSU_14440
Molecular weight
33.42 kDa
pI
6.14
Protein length
Gene length
function
biosynthesis of [metabolite|coenzyme A]
product
[metabolite|alpha-ketopantoate] reductase
essential
no
ec
1.1.1.-
synonyms
ykpB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1893 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,514,052  1,514,963
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[metabolite|alpha-ketopantoate] + H+ + [metabolite|NADPH] --> (R)-[metabolite|pantoate] + [metabolite|NADP]+ [https://www.biorxiv.org/content/10.1101/2024.04.17.589903v1.full.pdf bioRxiv]
Protein family
ketopantoate reductase family (with [protein|0F153803781C9AC8321FB14F926B645C45E53B00|panE], according to UniProt)
Structure
[PDB|3HN2] (from Geobacter metallireducens, 26% identity)
[AF|O31717]
Expression and Regulation
Operons
genes
[gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]-[gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|panG]
description
[pubmed|22383849]
Open in new tab

[gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]→[gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|panG]

2024-06-02 18:51:50

Jstuelk

61

ce96627e6bc3eef0cadea77f88cbe87d581da2c6

A36C5D7B9D14E75C8D85182AA49F8893F8382B7B

Biological materials
Mutant
MGNA-B353 (ykpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1352 NBRP B. subtilis, Japan]
BKE14440 ([gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|panG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTGATCTCCTTTCA,  downstream forward: _UP4_TAAAAAAAGGAGGCGGAAAA
BKK14440 ([gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|panG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTGATCTCCTTTCA,  downstream forward: _UP4_TAAAAAAAGGAGGCGGAAAA
GP3347 ([gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|panG]::lox72 trpC2), available in [wiki|Jörg Stülke]'s lab
GP3383 (Δ[gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|panG]::neo trpC2), available in [wiki|Jörg Stülke]'s lab

60264E4BE76F5995A8317294D05FC27F8B34E09D

Page visits: 1972

Time of last update: 2024-06-19 23:32:14

Author of last update: Jstuelk