

alanine sensor, [wiki|germination] response to L-alanine, triggers premature [wiki|germination] in response to morphological defects during [wiki|sporulation]

Molecular weight
41.30 kDa
Protein length
Gene length
germination response to L-alanine
alanine sensor of the nutrient-gated [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]-[protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]-[protein|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC] ion channel

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5902 (Galperin et al., 2021)

This gene is a member of the following regulons

3,392,199  3,393,296
Phenotypes of a mutant
suppresses the defects of [gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV] mutant spores [pubmed|28605069]
Visit Visit
The protein
Catalyzed reaction/ biological activity
the [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]-[protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]-[protein|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC] ion channel releases ions from the spore core in response to L-alanine to trigger [category|SW.4.2.4|Germination] [pubmed|37104613]
triggers premature [wiki|germination] in response to morphological defects during [wiki|sporulation] [pubmed|28605069]
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
[wiki|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
Paralogous protein(s)
[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE], [protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB], [protein|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]
predicted to be an integral membrane protein with ten membrane-spanning helices [Pubmed|21378181]
inner spore membrane [Pubmed|26731423]
Expression and Regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [wiki|SpoVT]) [Pubmed|16497325,15699190,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
additional information
1,100 molecules are present per spore [PubMed|23749970]
Open in new tab


2024-07-15 00:21:22





Biological materials
BKE33060 ([gene|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACAATAGAAATACCTTGAA,  downstream forward: _UP4_CTCAAGAGGAGGATTACAAC
BKK33060 ([gene|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACAATAGAAATACCTTGAA,  downstream forward: _UP4_CTCAAGAGGAGGATTACAAC
Original Publications


Page visits: 3226

Time of last update: 2024-07-17 18:26:46

Author of last update: Jstuelk