

UDP-N-acetylglucosamine 4,6-dehydratase, required for extracellular polysaccharide synthesis, this gene is inactive in B. subtilis 168

Molecular weight
66.09 kDa
Protein length
Gene length
[category|SW.4.1.2|Biofilm formation], biosynthesis of UDP-N,N’-diacetylbacillosamine (with [protein|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN] and [protein|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM])
UDP-N-acetylglucosamine 4,6-dehydratase
epsC, yveM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1086 (Galperin et al., 2021)

This gene is a member of the following regulons

3,526,407  3,528,203
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
UDP-N-acetylglucosamine (UDP-GlcNAc) --> UDP-2,6-dideoxy-2-acetamido 4-keto glucose (UDP-4-keto) [pubmed|30222950]
Protein family
[wiki|Polysaccharide synthase family] (according to UniProt)
NAD+ [pubmed|30222950]
[PDB|5BJW] (from Campylobacter jejuni, corresponds to the C-terminal part of EpsC, aa 242 ... 571, 47% identity) [pubmed|29053280]
Paralogous protein(s)
[protein|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU], (for SpsM)
[protein|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP], (for SpsM)
cell membrane (according to Swiss-Prot)
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2024-06-09 03:22:36





Biological materials
MGNA-A071 (yveM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/71 NBRP B. subtilis, Japan]
BKE34350 ([gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGTCTTCTCCGGT,  downstream forward: _UP4_AGCGTTCATTAGGGGGAGTG
BKK34350 ([gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGTCTTCTCCGGT,  downstream forward: _UP4_AGCGTTCATTAGGGGGAGTG
Research papers
The EAR [wiki|RNA switch]
Labs working on this gene/protein
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]


Page visits: 4681

Time of last update: 2024-07-15 16:29:38

Author of last update: Jstuelk