

orotidine 5-phosphate decarboxylase

Molecular weight
25.84 kDa
Protein length
Gene length
pyrimidine biosynthesis
orotidine-5-phosphate decarboxylase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0284 (Galperin et al., 2021)

This gene is a member of the following regulons

1,628,622  1,629,341
Phenotypes of a mutant
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
Visit Visit
The protein
Catalyzed reaction/ biological activity
H+ + orotidine 5'-phosphate --> CO2 + UMP (according to UniProt)
Protein family
OMP decarboxylase family (single member, according to UniProt)
Expression and Regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-18 17:36:24





Biological materials
BKE15550 ([gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGTGTTTCTTCAGCTGACG,  downstream forward: _UP4_GCCTATAAGGCTGTCAGACT
BKK15550 ([gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGTGTTTCTTCAGCTGACG,  downstream forward: _UP4_GCCTATAAGGCTGTCAGACT


Page visits: 4096

Time of last update: 2024-07-14 17:45:24

Author of last update: Melvin.boenninger