aroH

aroH
168

chorismate mutase (isozymes 1 and 2)

locus
BSU_22690
Molecular weight
14.38 kDa
pI
5.52
Protein length
Gene length
function
biosynthesis of aromatic amino acids
product
chorismate mutase (isozymes 1 and 2)
essential
no
ec
5.4.99.5
synonyms
aroH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4401 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,377,632  2,378,015
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Chorismate --> prephenate (according to UniProt)
[wiki|Domains]
Chorismate mutase aroH-type domain (aa 3-121) (according to UniProt)
Structure
[PDB|2CHT] (complex with a transition state analog) [pubmed|8378335]
[PDB|1DBF]
[AF|P19080]
Expression and Regulation
Operons
genes
[gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]-[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
description
[pubmed|22383849]
Open in new tab

[gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]→[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]

2024-06-19 20:42:18

Jstuelk

114

88965d20d1da4832592c311cace3ecbf90c44644

85AFABBE9DF5093CCB38A8A7CAF16B0DE8C014A7

genes
[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
description
[pubmed|21815947]
Open in new tab

[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]→[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]

2024-06-13 22:49:25

Jstuelk

56

11ded187035e045106d8194f04674749e2b39e61

BB6AEFA38C0BE93441F72C5C4A7B99691660ECBA

Biological materials
Mutant
BKE22690 ([gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTCCGCGAATTCCGCGAA,  downstream forward: _UP4_TAATACGATAAGAACAGCTT
BKK22690 ([gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTCCGCGAATTCCGCGAA,  downstream forward: _UP4_TAATACGATAAGAACAGCTT
References
Reviews
12698486,9383421,12966138
Original Publications
8378335,25422475,12630863,10960481,2105742,8643526,26278727,26641683,21243152,15034619,14709097,21815947,28743924,38618904

5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1

Page visits: 3296

Time of last update: 2024-06-20 19:53:44

Author of last update: Jstuelk