

transcriptional regulator ([wiki|Xre family]) of post-exponential-phase responses genes

Molecular weight
12.85 kDa
Protein length
Gene length
control of [wiki|biofilm formation]
transcriptional regulator ([wiki|Xre family])
sinR, sin, flaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1396 (Galperin et al., 2021)

This gene is a member of the following regulons

2,552,653  2,552,988
Phenotypes of a mutant
the mutation suppresses the galactose toxicity to a [gene|314223775ECB9E969F4F898584FC4E5379E86C7F|galE] mutant  [Pubmed|22893383]
additional information
the [gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] gene is often inactivated during adaptation to Arabidopsis thaliana [pubmed|37466402,37768063]
improved colonization on plant roots (inactivating mutations appear during growth on roots) [pubmed|38206029]
Visit Visit
The protein
Catalyzed reaction/ biological activity
transcription regulator of biofilm genes, acts as a true repressor of the ''[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]'' operon and as an anti-activator (prevents binding of the activator protein [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) of the ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]'' operon [Pubmed|23646920]
acts as co-repressor for [protein|920F91E748EE079FF864011D9052B073567C41E4|slrR] [Pubmed|20351052]
Protein family
[wiki|Xre family]
DNA-binding N-terminal domain (aa 1-69) [Pubmed|21708175]
[protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]-binding C-terminal domain (aa 74-111) [Pubmed|21708175]
[wiki|HTH cro/C1-type domain] (aa 6-61) (according to UniProt)
[wiki|Sin domain] (aa 65-103) (according to UniProt)
[PDB|2YAL] (C-terminal domain, aa 74-111) [Pubmed|21708175]
[PDB|3QQ6] (N-terminal domain, aa 1-69) [Pubmed|21708175]
[PDB|1B0N] (complex [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]) [Pubmed|9799632]
Effectors of protein activity
[protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI] and [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] are antagonists to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]  [Pubmed|19788541]
[protein|920F91E748EE079FF864011D9052B073567C41E4|slrR] is also antagonist of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] [Pubmed|20351052]
Paralogous protein(s)
Expression and Regulation
repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]) [,11751836 PubMed]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, in a portion of cells [Pubmed|11751836], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|1664536], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|7635837,11751836], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [PubMed|1906467,11751836], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3125149], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab


2024-07-02 16:02:11





additional information
the mRNA is stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 3.5 to 13 min) [PubMed|21815947]
Open in new tab


2024-07-08 12:18:30





Biological materials
GP923 (''sinR::spec'') [Pubmed|21856853], available in [wiki|Jörg Stülke]'s lab
GP736 (''sinR::tetR'') [Pubmed|24493247], available in [wiki|Jörg Stülke]'s lab
1S97 (''sinR''::''phleo''), [Pubmed|8422983], available at [ BGSC]
GP1672 (''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]''::''cat'') [Pubmed|24493247], available in [wiki|Jörg Stülke]'s lab
GP1663 (''[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]-[gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]-[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]''), available in [wiki|Jörg Stülke]'s lab
BKE24610 ([gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATCACCTTCCTTG,  downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC
BKK24610 ([gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATCACCTTCCTTG,  downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC
Expression vectors
N-terminal Strep-tag, for [wiki|SPINE], expression in ''B. subtilis'', in [wiki|pGP380]: pGP1083 , available in [wiki|Jörg Stülke]'s lab
pGP2330: in [wiki|pBQ200], for expression in B. subtilis, available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP960 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP1930 (aphA3) based on [wiki|pAC7], available in [wiki|Jörg Stülke]'s lab
Original Publications


Page visits: 12679

Time of last update: 2024-07-15 04:52:50

Author of last update: Jstuelk