yybN

yybN
168

unknown

locus
BSU_40580
Molecular weight
16.02 kDa
pI
9.53
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yybN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,173,114  4,173,551
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[AF|P37490]
Expression and Regulation
Operons
genes
[gene|5A68286ADFB1B334DC626612C74D03AE4DBAF0A7|yybN]-[gene|BA4CB875FD72C7E7767AFA44A5D8C32448F5E18C|yybM]-[gene|CE98D731B8D9BDBF4EB119346BB59F5E5C48C827|yybL]-[gene|8950AD10BE5B6EDA74C341D272201D1BA9DBAC85|yybK]-[gene|6260516A5ED4A49457997592F29CEC10B7A2CCA7|yybJ]
description
[pubmed|22383849]
regulation
repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[wiki|DnaA] [Pubmed| 27902860,15743949]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA] [Pubmed|27902860,15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA] [Pubmed|27902860,15743949], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
Open in new tab

[gene|5A68286ADFB1B334DC626612C74D03AE4DBAF0A7|yybN]→[gene|6260516A5ED4A49457997592F29CEC10B7A2CCA7|yybJ]

2024-07-02 15:57:54

Jstuelk

50

7269b326596a2b101b6906259d47b3c6c5f251ce

5AE2E862BF55A5CF21A83C6468D64DAD9CCB6367

Biological materials
Mutant
MGNA-B840 (yybN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1839 NBRP B. subtilis, Japan]
BKE40580 ([gene|5A68286ADFB1B334DC626612C74D03AE4DBAF0A7|yybN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATTTTACAATCCTTTC,  downstream forward: _UP4_TAAACAAGAACCTTCTAAAA
BKK40580 ([gene|5A68286ADFB1B334DC626612C74D03AE4DBAF0A7|yybN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATTTTACAATCCTTTC,  downstream forward: _UP4_TAAACAAGAACCTTCTAAAA
References
Reviews
36882621
Original Publications
15743949,20525796,23199363,27902860

5A68286ADFB1B334DC626612C74D03AE4DBAF0A7

Page visits: 3331

Time of last update: 2024-07-14 17:05:39

Author of last update: Jstuelk