citZ

citZ
168

citrate synthase

locus
BSU_29140
Molecular weight
41.57 kDa
pI
5.45
Protein length
Gene length
function
TCA cycle
product
citrate synthase II
essential
no
ec
2.3.3.1
synonyms
citZ, citA2

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0372 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,981,151  2,982,269
Phenotypes of a mutant
glutamate auxotrophy and a defect in sporulation [Pubmed|8045898]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
acetyl-CoA + H2O + oxaloacetate --> citrate + CoA + H+ (according to UniProt)
Protein family
citrate synthase family (with [protein|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD] and [protein|6684F6083B001E9FDC5967799B715AE966B83E1D|citA], according to UniProt)
Structure
[PDB|2C6X]
[PDB|A discussion of citrate synthase structure]
[AF|P39120]
Modification
phosphorylation on Ser-284 [Pubmed|17218307]
Effectors of protein activity
Inhibited by acetyl-CoA, 2-oxoglutarate and NADH [Pubmed|4211224] [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T36-44C8RWC-SH&_user=5731894&_coverDate=01/01/1985&_rdoc=28&_fmt=high&_orig=browse&_srch=doc-info(#toc#4938#1985#998209998#270526#FLP#display#Volume)&_cdi=4938&_sort=d&_docanchor=&_ct=40&_acct=C000043105&_version=1&_urlVersion=0&_userid=5731894&md5=f14f4734123ab1177d7217cab6c7ce7d FEBS Letters]
Inhibited by citrate and CoA (competitively against acetyl-CoA and non-competitively against oxaloacetate) [Pubmed|4211224]
Inhibited by ATP competitively in ''B. subtilis'' strain 168 and HS 1A17 [Pubmed|4980242] [Pubmed|4211224]
In ''B. subtilis'' strain HS 2A2, ATP inhibits a non-competitive fashion [Pubmed|4211224]
Activated by AMP [Pubmed|4211224]
Paralogous protein(s)
[protein|6684F6083B001E9FDC5967799B715AE966B83E1D|citA], [protein|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]
[wiki|Localization]
cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
Additional information
extensive information on the structure and enzymatic properties of CitZ can be found at [http://www.proteopedia.org/wiki/index.php/Citrate_synthase Proteopedia]
Expression and Regulation
Operons
genes
[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
description
[Pubmed|8045899]
regulation
''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|12100558]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: transcription repression [Pubmed|12100558], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|protein:FE15A41A58A8177280817CA3825764C39185021A|ccpC regulon]
[protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]: mRNA stability control, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|protein:E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8045899], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]→[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]

2024-07-14 22:09:55

Jstuelk

86

d65e97dee2d196244ee89dd42bbf730b7ea9c870

F01A9D3586F0AD300B6C4F086E56F8AEA52D457F

Biological materials
Mutant
GP678 (erm), GP797 (spec) available in [wiki|Jörg Stülke]'s lab
1A999 (''citZ''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]
GP790 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', available in [wiki|Jörg Stülke]'s lab
GP797 (''citZ''::''spec''), allows expression of ''[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]'' and ''[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'', available in [wiki|Jörg Stülke]'s lab
GP1281 (''citZ''::''erm''), allows expression of ''[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]'' and ''[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'', available in [wiki|Jörg Stülke]'s lab
GP2331 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [wiki|Jörg Stülke]'s lab
GP2333 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
BKE29140 ([gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATAACATCTCCTTTT,  downstream forward: _UP4_TAAAGAACCATTGGAGGCTG
BKK29140 ([gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATAACATCTCCTTTT,  downstream forward: _UP4_TAAAGAACCATTGGAGGCTG
Expression vectors
pGP1120 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Jörg Stülke]'s lab) [pubmed|20933603]
pGP1776 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab)
pGP1761 (expression with N-terminal His-tag from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP2515 (N-terminal Strep-tag, purification from ''E. coli'', in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
pGP2261 (integration into [gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA], expression under the control of the xylose-inducible PxylA promoter in ''B. subtilis'', in [wiki|pGP888]), available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Linc Sonenshein]'s lab
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
References
Reviews
3013232,38958532
Original Publications
36815589,10348849,8045899,22900538,10656796,12850135,17218307,12100558,9642180,8045898,8655569,4211224,4980242,20525796,24825009,20933603,23354745,24571712,29546354

58E3A065A95D03B4FB1F544906F53D1704D29EAD

Page visits: 8455

Time of last update: 2024-07-15 07:55:37

Author of last update: Jstuelk