gcvH

gcvH
168

glycine cleavage system protein H, lipoyl-binding site, octanoyltransferase for lipoic acid biosynthesis, required for lipoate transfer to 2-oxo acid dehydrogenases

locus
BSU_32800
Molecular weight
14.11 kDa
pI
3.89
Protein length
Gene length
function
glycine utilization
product
glycine cleavage system protein H
essential
no
synonyms
gcvH, yusH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0509 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,366,123  3,366,506
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
degradation of glycine. [protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH] shuttles the methylamine group of glycine from [protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB] to [protein|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT] (according to UniProt)
assembly of lipoate, and transfer of the cofactor to [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC], and [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
Protein family
gcvH family (single member, according to UniProt)
[wiki|Domains]
[wiki|Lipoyl-binding domain] (aa 22-104) (according to UniProt)
[wiki|Cofactors]
lipoic acid (on Lys-63), lipoylated by [protein|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM] [Pubmed|20882995], can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN] [pubmed|28900027]
Structure
[PDB|3IFT] (from ''Mycobacterium tuberculosis'', 50% identity) [Pubmed|20364333]
[AF|O32174]
Expression and Regulation
Operons
genes
[gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]-[gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]-[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]
description
[Pubmed|22383849]
Open in new tab

[gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]→[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]

2024-06-19 06:51:51

Jstuelk

62

7cad883987d1f83ff558362c4d0433757aa19479

21AA0A8075776ECD01FD07F91813709517E166D0

genes
[gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]-[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]
description
[Pubmed|22383849]
Open in new tab

[gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]→[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]

2024-05-27 15:09:12

Jstuelk

56

98a2e24323acf1d2aa7bfbc5056b6f1c976555d8

2B958446078CD7A725227A3BE0AC8498C0E62616

Biological materials
Mutant
MGNA-B592 (yusH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1591 NBRP B. subtilis, Japan]
BKE32800 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGAATCCCTCCATTTT,  downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
BKK32800 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGAATCCCTCCATTTT,  downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
GP2585 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::tet comIQ12L) (in DK1042) available in [wiki|Jörg Stülke]'s lab
References
Reviews
27074917,38624243
Original Publications
20882995,21338421,20364333,28900027,29339506,31066113

58CF62EBA28E77668A0B5319142C8AC20D81CD8A

Page visits: 2366

Time of last update: 2024-06-18 01:42:38

Author of last update: Jstuelk