mdh

mdh
168

malate dehydrogenase

locus
BSU_29120
Molecular weight
33.49 kDa
pI
4.73
Protein length
Gene length
function
TCA cycle
product
malate dehydrogenase
essential
no
ec
1.1.1.37
synonyms
mdh, citH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0039 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,978,734 2,979,672
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(S)-malate + NAD+ --> H+ + NADH + oxaloacetate (according to UniProt)
Protein family
LDH/MDH superfamily (with [protein|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh], according to UniProt)
[wiki|Cofactors]
NAD+
Structure
[PDB|3TL2] (from ''B. anthracis'', 85% identity)
[AF|P49814]
Modification
phosphorylated on Arg-156 [Pubmed|22517742]
phosphorylation on Ser-149 [Pubmed|17218307]
Effectors of protein activity
Inhibited by Mg2+, Ca2+, Zn2+, Ag2+ and Hg2+ [Pubmed|14284712] [Pubmed|922015]
Inhibited by oxaloacetate (above 1mM) and malate (above 7,7mM) [Pubmed|14284712]
[wiki|Localization]
cytoplasm (according to UniProt)
membrane associated [Pubmed|18763711]
Additional information
The enzyme is a tetramer [Pubmed|14284712]
extensive information on the structure and enzymatic properties of Mdh can be found at [http://www.proteopedia.org/wiki/index.php/Malate_dehydrogenase Proteopedia]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
description
[Pubmed|8045899]
regulation
''[protein|search|citZ]'': catabolite repression ([protein|search|CcpA]) [Pubmed|12100558]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: transcription repression [Pubmed|12100558], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|protein:FE15A41A58A8177280817CA3825764C39185021A|ccpC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8045899], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]→[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]

2024-05-21 19:50:00

ghost

65

f9ad3d456cafa7c9074216bd662b61b54e3995fc

2BD9E142645FECA776F7762A7431A0FB5A5D9070

genes
[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
description
[Pubmed|8045899]
regulation
''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|12100558]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: transcription repression [Pubmed|12100558], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|protein:FE15A41A58A8177280817CA3825764C39185021A|ccpC regulon]
[protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]: mRNA stability control, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|protein:E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8045899], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]→[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]

2024-05-21 10:11:33

Jstuelk

74

d65e97dee2d196244ee89dd42bbf730b7ea9c870

F01A9D3586F0AD300B6C4F086E56F8AEA52D457F

Biological materials
Mutant
GP719(spc) & GP1150(spc), available in [wiki|Jörg Stülke]'s lab [pubmed|20933603]
GP790 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', available in [wiki|Jörg Stülke]'s lab
GP2331 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [wiki|Jörg Stülke]'s lab
GP2333 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
BKE29120 ([gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTTCTCCTTTA, downstream forward: _UP4_TAATAAAAAGAGAGAAAGGC
BKK29120 ([gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTTCTCCTTTA, downstream forward: _UP4_TAATAAAAAGAGAGAAAGGC
Expression vectors
pGP385: for expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844], available in [wiki|Jörg Stülke]'s lab
pGP1123 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Jörg Stülke]'s lab) [pubmed|20933603]
pGP1755 (expression / purification of Mdh-S149A, with N-terminal His-tag from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP1764 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab)
GP1438(''mdh''-''Strep'' ''(spc)'') & GP1440(''mdh''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1130 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab [pubmed|20933603]
Antibody
**
GFP fusion
GP1431 (spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab
References
36815589,10656796,18763711,14284712,922015,12100558,17218307,8550482,8045899,20933603,22517742,23136871,24325460,15378759,24571712,29546354,36534341

5832127A2D0BD4AF2E891C93DC7C45221055FFC5

Page visits: 7605

Time of last update: 2024-05-23 12:50:49

Author of last update: Jstuelk