yvsH

yvsH
168

putative lysine transporter

locus
BSU_33330
Molecular weight
50.09 kDa
pI
9.74
Protein length
Gene length
function
uptake of lysine
product
putative lysine transporter
essential
no
synonyms
yvsH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0531 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,419,656  3,421,065
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|3LRB] (from ''E. coli'', 32% identity) [Pubmed|19478139]
[AF|O32204]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|5762418690734FB959506B7317208CCA1A340720|yvsH]
description
[pubmed|22383849]
regulatory mechanism
L-box: RNA switch, via a riboswitch, in [regulon|other_regulator:L-box|L-box]
Open in new tab

[gene|5762418690734FB959506B7317208CCA1A340720|yvsH]

2024-05-21 04:12:38

Bzhu

41

f957c1c6850cf1d92855c839b68ace2c66c37937

FEC8D0D4B84D9B3F687B1E2B2A5FB4810FE6784E

Biological materials
Mutant
GP4153 (Δ[gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::''aphA3''), available in [wiki|Jörg Stülke]'s lab
MGNA-B067 (yvsH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1066 NBRP B. subtilis, Japan]
BKE33330 ([gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT,  downstream forward: _UP4_TAATGAAAAGACACCTGATT
BKK33330 ([gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT,  downstream forward: _UP4_TAATGAAAAGACACCTGATT
References
18763711,14627808,19478139

5762418690734FB959506B7317208CCA1A340720

Page visits: 1898

Time of last update: 2024-06-22 21:31:55

Author of last update: MBenda