ndh

ndh
168

NADH dehydrogenase (Menaquinone 7 & no proton)

locus
BSU_12290
Molecular weight
41.79 kDa
pI
6.29
Protein length
Gene length
function
respiration
product
NADH dehydrogenase (Menaquinone 7 & no proton)
essential
no
synonyms
ndh, yjlD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1252 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,299,074 1,300,252
Phenotypes of a mutant
inactivation of ''ndh'' facilitates growth without a cell wall (due to reduction of oxidative stress) [Pubmed|26051891]
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
NADH dehydrogenase family (with [protein|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|yutJ] and [protein|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|yumB], according to UniProt)
[wiki|Cofactors]
FAD [pubmed|31133996]
Structure
[PDB|4NWZ] (from ''C. thermarum'', 42% identity) [Pubmed|24444429]
[AF|P80861]
Paralogous protein(s)
[protein|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|yumB]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]-[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]
description
[Pubmed|17015645]
regulation
induced at high NADH+ levels ([protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]) [Pubmed|17015645]
repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]) [pubmed|28439033,10913079]
regulatory mechanism
[protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]: repression, [Pubmed|17015645], in [regulon|protein:B5EF521437323EF43F08E5EFDB5C798616CA499A|rex regulon]
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: repression, [pubmed|28439033], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
Open in new tab

[gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]→[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]

2024-05-21 08:01:42

Jstuelk

98

8fc075b2517874a07db87d69d9d785f0de7f3d21

1C60502BB7D833D4CC4509CD6E259B0F8D511F21

genes
[gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]-[gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]-[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]
description
[pubmed|22383849]
Open in new tab

[gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]→[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]

2024-05-21 22:21:20

Jstuelk

101

d86a69dcbb03e87c0c11960d4290b254a76a2100

D56200C8EE048511C4EFA1B76D998771F9C5F8C9

Biological materials
Mutant
MGNA-A358 (yjlD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/358 NBRP B. subtilis, Japan]
BKE12290 ([gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATATCCTCCGTCCT, downstream forward: _UP4_TAATCCTTTTAATGAATCTG
BKK12290 ([gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATATCCTCCGTCCT, downstream forward: _UP4_TAATCCTTTTAATGAATCTG
References
36815589,17015645,20933603,11948165,18763711,15378759,26051891,24444429,28439033,10913079,28189581,31133996

56F407D408272F3674612C9CDFE4A922680EC694

Page visits: 6436

Time of last update: 2024-05-23 08:36:35

Author of last update: Jstuelk