yxjH

yxjH
168

putative methionine synthase

locus
BSU_38950
Molecular weight
38.14 kDa
pI
5.09
Protein length
Gene length
function
unknown
product
putative methionine synthase
essential
no
synonyms
yxjH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0620 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,997,964  3,999,097
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[PDB|1YPX] (the enzyme from ''Listeria monocytogenes'', 50% identity)
[AF|P42319]
Paralogous protein(s)
[protein|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|yxjG]
Expression and Regulation
Operons
genes
[gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]
description
[Pubmed|10746760]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
Open in new tab

[gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]

2024-05-30 16:23:41

Jstuelk

41

46568a4a7a00b89060a0b1fdd6c47ee0a6a68830

38C88161252FB4559F304DC8B25CC6BE2483803B

Biological materials
Mutant
MGNA-B732 (yxjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1731 NBRP B. subtilis, Japan]
BKE38950 ([gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCGCCTCTTTTC,  downstream forward: _UP4_TAATCTATCATTGACAGAAA
BKK38950 ([gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCGCCTCTTTTC,  downstream forward: _UP4_TAATCTATCATTGACAGAAA
References
19258532,10094622,18039762,12107147

55459D8F0BBB2669EB9F25276A17F1A7EB322AF1

Page visits: 3066

Time of last update: 2024-06-19 13:08:56

Author of last update: Bzhu