

pyrroline-5-carboxylate reductase

Molecular weight
31.88 kDa
Protein length
Gene length
osmoadaptive de novo production of proline
pyrroline-5-carboxylate reductase
proH, yoxE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0345 (Galperin et al., 2021)

This gene is a member of the following regulons

2,016,845  2,017,738
Visit Visit
The protein
Catalyzed reaction/ biological activity
1-pyrroline-5-carboxylate + NAD(P)H + H+ --> L-proline + NAD(P)+ [pubmed|28824574]
Protein family
[wiki|pyrroline-5-carboxylate reductase family] [pubmed|28824574]
NADPH [pubmed|28824574]
[PDB|5BSE] (from ''Medicago truncatula'', 36% identity) [pubmed|26579138]
Effectors of protein activity
feedback-inhibited by proline [pubmed|28824574]
Paralogous protein(s)
cytoplasm (according to Swiss-Prot)
Expression and Regulation
expressed under conditions of osmotic stress [Pubmed|35593133,21784929]
induced upon antibiotic stress [pubmed|35593133]
expression is heterogeneously activated [pubmed|35593133]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21784929], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-04 16:22:59





Biological materials
HB24914 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::''erm''), available in [wiki|John Helmann]'s and [wiki|Jörg Stülke]'s labs
MGNA-B083 (proH::erm), available at the [ NBRP B. subtilis, Japan]
BKE18480 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCACACGTTTAAAAT,  downstream forward: _UP4_GCGCCGCTATCAGGAGTGAT
BKK18480 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCACACGTTTAAAAT,  downstream forward: _UP4_GCGCCGCTATCAGGAGTGAT
GP3709 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::aphA3 trpC2) available in the [wiki|Stülke] lab
Expression vectors
pGP3800: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
pGP3862: expression of Strep-''proH'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
Original Publications


Page visits: 8861

Time of last update: 2024-06-13 22:33:13

Author of last update: Robert.warneke