lmrA

lmrA
168

transcriptional regulator ([wiki|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|search|yxaH ]and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]

locus
BSU_02680
Molecular weight
20.52 kDa
pI
5.03
Protein length
Gene length
function
regulation of [metabolite|lincomycin] resistance
product
transcriptional regulator
essential
no
synonyms
lmrA, lin-2, yccB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
290,132  290,698
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 4-64) (according to UniProt)
Structure
[PDB|1SGM] ([protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR], 56% identity) [pubmed|16475182]
[AF|O34619]
Effectors of protein activity
flavonoids such as [metabolite|quercetin] serve as inducers, binding results in release from DNA [Pubmed|17483215]
Paralogous protein(s)
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]
Expression and Regulation
Operons
genes
[gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
description
[Pubmed|15317768]
regulation
induced by flavonoids such as quercetin ([protein|search|LmrA])[Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12499232], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]→[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]

2024-06-15 23:06:07

ghost

82

be7795d98f26be96a984dc95802c21f2dcb1e545

FCA0758D41C878E1059BF369D1C30C97AACB6B0C

Biological materials
Mutant
BKE02680 ([gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT,  downstream forward: _UP4_TAAAAAAAACGACATACTAC
BKK02680 ([gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT,  downstream forward: _UP4_TAAAAAAAACGACATACTAC
References
Reviews
24006471,25209494
Original Publications
15317768,17483215,12499232,21815947,16475182

52D560AA02F0849CB24460A496021560063B2E12

Page visits: 5590

Time of last update: 2024-06-20 12:23:43

Author of last update: Jstuelk