

similar to pyruvyltransferase, extracellular polysaccharide synthesis

Molecular weight
37.12 kDa
Protein length
Gene length
biofilm formation
epsO, yvfF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5039 (Galperin et al., 2021)

This gene is a member of the following regulons

3,514,115  3,515,083
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
polysaccharide pyruvyl transferase family (with [protein|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI] and [protein|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB], according to UniProt)
[PDB|5AX7] (from yeast, corresponds to aa 79 ... 303, 30% identity) [pubmed|27194449]
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2024-06-09 03:22:36





Biological materials
MGNA-B608 (yvfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1607 NBRP B. subtilis, Japan]
BKE34220 ([gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGACAGTTTCTGTTTCAGGC,  downstream forward: _UP4_CCTGCTCACATGTGAGCGGA
BKK34220 ([gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGACAGTTTCTGTTTCAGGC,  downstream forward: _UP4_CCTGCTCACATGTGAGCGGA
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
Research papers
The EAR [wiki|RNA switch]


Page visits: 4070

Time of last update: 2024-07-15 06:02:14

Author of last update: Jstuelk