

UDP-N-acetyl-glucosamine transferase, synthesis of extracellular poly-N-acetylglucosamine

Molecular weight
39.79 kDa
Protein length
Gene length
synthesis of extracellular poly-N-acetylglucosamine
UDP-N-acetyl-glucosamine transferase
epsJ, yveT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0463 (Galperin et al., 2021)

This gene is a member of the following regulons

3,518,999  3,520,033
Visit Sartorius.com Visit Sartorius.com
The EAR [wiki|RNA switch]
The protein
Protein family
[wiki|glycosyltransferase 2 family] (according to UniProt)
Paralogous protein(s)
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2024-06-09 03:22:36





Biological materials
MGNA-A066 (yveT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/66 NBRP B. subtilis, Japan]
BKE34280 ([gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACAATAATGCTGACGAGCG,  downstream forward: _UP4_ATGAAAGGCAGTGCGAAGCA
BKK34280 ([gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACAATAATGCTGACGAGCG,  downstream forward: _UP4_ATGAAAGGCAGTGCGAAGCA
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]


Page visits: 4006

Time of last update: 2024-07-14 20:00:26

Author of last update: Melvin.boenninger