yukE

yukE
168

secreted protein of the WXG100 superfamily, homolog of virulence factor EsxA

locus
BSU_31910
Molecular weight
9.00 kDa
pI
7.91
Protein length
Gene length
function
secretion and delivery of [wiki|LXG domain] toxins
product
[wiki|LXG domain] toxin delivery factor
essential
no
synonyms
yukE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4842 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,276,141 3,276,434
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
secretion and delivery of [wiki|LXG domain] toxins [pubmed|34280190]
Protein family
WXG100 family (with [protein|A177DF098115F85F23A1D42EFB07D294B515830F|yfjA], according to UniProt) (pfam06013) [Pubmed|11973144]
Structure
[PDB|3ZBH] (from Geobacillus thermodenitrificans, 59% identity)
[AF|C0SP85]
[wiki|Localization]
secreted, by the type VII [wiki|protein secretion] system [protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[protein|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[protein|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[protein|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC] [Pubmed|24828531,23861817]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]
description
[Pubmed|22383849]
Open in new tab

[gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]

2024-05-18 19:31:46

Jstuelk

66

80ce13c3d596fe7a821b7b237bab0c04160826a4

347B5EC3EC1EF12B4D52DBAAF8B896AF2EB4BDF2

genes
[gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]-[gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[gene|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[gene|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]-[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
description
[Pubmed|22383849]
regulation
expressed in the stationary phase [Pubmed|23861817]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|23861817], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22383849], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]→[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]

2024-05-16 09:12:53

Jstuelk

95

BB0E1B9684F16E121BAA022EF986B0285FB41FA7

CDC40F8A7006CF56CF9A6155897E8BD27FFEC7AA

Biological materials
Mutant
MGNA-A628 (yukE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/628 NBRP B. subtilis, Japan]
BKE31910 ([gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCTCATTACCTCCT, downstream forward: _UP4_TAACAGTATGAAAGGGAAGG
BKK31910 ([gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCTCATTACCTCCT, downstream forward: _UP4_TAACAGTATGAAAGGGAAGG
References
15576783,22383849,11973144,23861817,23861817,15378759,24798022,24696501,21395229,24828531,33782055,34280190,34521822,36154281

50D2A03E2D7B5D461540FD157377E0D37F771888

Page visits: 5152

Time of last update: 2024-05-23 13:49:13

Author of last update: Jstuelk