cwlO

cwlO
168

D,L-endopeptidase-type autolysin, primary autolytic pathway for cell elongation

locus
BSU_34800
Molecular weight
50.87 kDa
pI
5.33
Protein length
Gene length
function
cell wall synthesis, cell elongation
product
endopeptidase-type autolysin
essential
no
synonyms
cwlO, yzkA, yvcE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3883 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,574,363  3,575,784
Phenotypes of a mutant
a [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE] mutant is not viable [Pubmed|17581128,22139507]
a [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI] mutant is not viable, due to lack of expression of [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE] [Pubmed|36265902]
a [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP] mutant is not viable, due to lack of processing of [protein|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI] and the resulting inactivity of [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI] [Pubmed|36265902]
a [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|59A7B26F810D7FEB07C176A8B2ECF6B83803DE49|ecsA] mutant is not viable, due to lack of processing of [protein|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI] and the resulting inactivity of [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI] [Pubmed|36265902]
a [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB] mutant is not viable, due to lack of processing of [protein|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI] and the resulting inactivity of [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI] [Pubmed|36265902]
shorter, fatter cells, this can be rescued by addition of Mg(2+) [Pubmed|23869552,23855774]
the mutant cells are thicker and shorter than wild type cells [pubmed|34846166]
loss of genetic competence [pubmed|29553055]
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
improved survival after [category|SW.3.1.1|DNA replication] arrest imposed by inhibition of [protein|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC] activity [pubmed|36574412]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
degradation of gamma-polyglutamic acid [pubmed|29458655]
Protein family
[wiki|Peptidase C40 family] (according to UniProt)
[wiki|Domains]
C-terminal D,L-endopeptidase domain ([wiki|NlpC/P60 domain]) [pubmed|29458655,22139507]
Structure
[AF|P40767]
Effectors of protein activity
[protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] requires activation by [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX] [Pubmed|23869552,23855774]
activity requires functional [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl] [Pubmed|23869552]
both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|iseA] [pubmed|29458655]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
localizes to the outer lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
cell membrane in a [protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]-dependent manner [Pubmed|23869552]
Expression and Regulation
Operons
genes
[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]
description
[pubmed|22383849]
regulation
expressed during exponential growth ([protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]) [pubmed|17581128]
the leader mRNA is processed by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
regulatory mechanism
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]: activation, [pubmed|17581128], in [regulon|protein:7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|24163346], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]

2024-07-08 05:40:04

Jstuelk

96

7e09d7d3f00ab2b73e135067be0bda5f80d9f891

3DC8D2D0BCFFCE0B13AA82019E60215F6FEDB87D

Biological materials
Mutant
GP2642 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::''aphA3''), available in [wiki|Jörg Stülke]'s lab
MGNA-B643 (yvcE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1642 NBRP B. subtilis, Japan]
BKE34800 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTATATCCTCCCTT,  downstream forward: _UP4_TAATAAATATGACAAGGGCC
BKK34800 ([gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTATATCCTCCCTT,  downstream forward: _UP4_TAATAAATATGACAAGGGCC
References
Reviews
23066944,18266855,33450852,33709487
Original Publications
21478646,16233686,17581128,20525796,18957862,20059685,22139507,23855774,23869552,24163346,27118079,29553055,29794222,29458655,29458657,29465029,34846166,34871030,35638827,36265902,36574412,37333659,37768080

4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872

Page visits: 8528

Time of last update: 2024-07-14 21:48:14

Author of last update: Jstuelk