ribE

ribE
168

riboflavin synthase (alpha subunit)

locus
BSU_23270
Molecular weight
23.33 kDa
pI
5.84
Protein length
Gene length
function
riboflavin biosynthesis
product
riboflavin synthase (alpha subunit)
essential
no
ec
2.5.1.9
synonyms
ribE, ribB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0307 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,429,600  2,430,247
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
2 6,7-dimethyl-8-(1-D-ribityl)lumazine + H+ --> 5-amino-6-(D-ribitylamino)uracil + riboflavin (according to UniProt)
Structure
[PDB|1I8D] (from ''E. coli'', 36% identity, 59% similarity) [Pubmed|11377200], , [PDB|1RVV] (the [protein|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE])3-([protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH])60 lumazine synthase/riboflavin synthase complex) [Pubmed|7473709]
[AF|P16440]
[wiki|Localization]
cytoplasm [pubmed|34474681]
Expression and Regulation
Operons
genes
[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
description
[Pubmed|8159171]
regulation
expressed in the absence of FMN ([wiki|FMN-box]) [Pubmed|15808508]
binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR] to the [wiki|FMN-box] riboswitch can enforce expression even in the presence of FMN [pubmed|26494285]
the [wiki|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
FMN-box: RNA switch, via [wiki|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR], in [regulon|other_regulator:FMN-box|FMN-box]
[protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]: antitermination, [pubmed|26494285], in [regulon|protein:3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8159171], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]→[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]

2024-06-08 12:44:39

Jstuelk

99

3D660447137821317811200D29A5FC04A41E938E

05C8A4E892E7DB3D953FE72E8765638644759326

Biological materials
Mutant
GP203 (erm), available in [wiki|Jörg Stülke]'s lab
BKE23270 ([gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTCCTGTAAACATGGTCA,  downstream forward: _UP4_GGCTTTTAGAGAGGAAGATT
BKK23270 ([gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTCCTGTAAACATGGTCA,  downstream forward: _UP4_GGCTTTTAGAGAGGAAGATT
References
Reviews
11395405
Original Publications
12456892,15808508,11377200,8159171,7934830,7473709,23270261,24442413,26494285,29087189,34474681,35495702

4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F

Page visits: 2621

Time of last update: 2024-06-23 03:16:22

Author of last update: Jstuelk