rpsU

rpsU
168

ribosomal protein bS21

locus
BSU_25410
Molecular weight
6.69 kDa
pI
11.58
Protein length
Gene length
function
translation
product
ribosomal protein S21 (bS21)
essential
no
synonyms
rpsU, yqeX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0828 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,620,371  2,620,544
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
bacterial [wiki|ribosomal protein] bS21 family (single member, according to UniProt)
Structure
[PDB|3J9W] (the [wiki|ribosome]) [Pubmed|25903689]
[AF|P21478]
Additional information
this ribosomal protein is lacking in some bacteria [pubmed|33753464]
Expression and Regulation
Operons
genes
[gene|4C79DEC2524735E3D32F967D511C5B0761D503A5|rpsU]-[gene|ED016475DF70DC63EE97B9FFD0CAC026E13A10E3|yqeY]
description
[pubmed|22383849]
regulation
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
expression
expression is increased upon depletion of depletion of tRNA maturation factors [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB] or [gene|C40C5D35ED53D343C8200248FCCB010BAB388054|rnz] [pubmed|36840557]
Open in new tab

[gene|4C79DEC2524735E3D32F967D511C5B0761D503A5|rpsU]→[gene|ED016475DF70DC63EE97B9FFD0CAC026E13A10E3|yqeY]

2024-07-15 03:21:47

Jstuelk

69

A918389A4AB8A12CC84F2E1A80FF85D64562FCD6

1E7C0CBF7A30E6527B75C695225F203C2C0DCA9A

Biological materials
Mutant
BKE25410 ([gene|4C79DEC2524735E3D32F967D511C5B0761D503A5|rpsU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTTTCCCTCCCTCC,  downstream forward: _UP4_AAATTCTAAAAGAGGGTGGA
BKK25410 ([gene|4C79DEC2524735E3D32F967D511C5B0761D503A5|rpsU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTTTCCCTCCCTCC,  downstream forward: _UP4_AAATTCTAAAAGAGGGTGGA
References
36815589,19653700,23002217,25035996,25903689,28516784,33753464,33782055,36840557

4C79DEC2524735E3D32F967D511C5B0761D503A5

Page visits: 5141

Time of last update: 2024-07-14 17:22:47

Author of last update: Jstuelk