

similar to spermidine/spermine N-acetyltransferase

Molecular weight
18.89 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1670 (Galperin et al., 2021)

This gene is a member of the following regulons

2,020,611  2,021,144
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|N-acetyltransferase domain] (aa 10-177) (according to UniProt)
[PDB|5WIF] (from Yersinia pestis, 29% identity)
Paralogous protein(s)
[protein|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB], [protein|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]
Expression and Regulation
induced by stress ([protein|search|SigB]) [Pubmed|10482513,15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10482513,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab


2024-07-19 17:19:30





Biological materials
MGNA-A832 (yoaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/832 NBRP B. subtilis, Japan]
GP1248 (''yoaA''::''tet''), available in [wiki|Jörg Stülke]'s lab
GP1255 (''[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]''::''kan'' ''[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''cat'' ''[gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]''::''spec'' ''[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]''::''tet''), available in [wiki|Jörg Stülke]'s lab
BKE18530 ([gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAACCACTCCCCACGT,  downstream forward: _UP4_TGACGGTATTCTCTTGGTCT
BKK18530 ([gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAACCACTCCCCACGT,  downstream forward: _UP4_TGACGGTATTCTCTTGGTCT


Page visits: 2049

Time of last update: 2024-07-20 19:08:42

Author of last update: Melvin.boenninger