pdhB

pdhB
168

pyruvate dehydrogenase (E1 beta subunit)

locus
BSU_14590
Molecular weight
35.32 kDa
pI
4.55
Protein length
Gene length
function
links glycolysis and TCA cycle
product
pyruvate dehydrogenase (E1 beta subunit)
essential
no
ec
1.2.4.1
synonyms
pdhB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0022 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,529,445 1,530,422
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[dihydrolipoyllysine-residue acetyltransferase]-(R)-N6-lipoyl-L-lysine + H+ + pyruvate --> [dihydrolipoyllysine-residue acetyltransferase]-(R)-N6-(S8-acetyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)
Structure
[PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus'')
[AF|P21882]
Modification
phosphorylation on (Ser-302 OR Ser-306) [Pubmed|17218307]
Effectors of protein activity
Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
Low sensibility to NADPH
inhibited upon interaction with [protein|5959516D55C9EDBFC46F28C8248D374832895740|pdhI] [pubmed|36815589]
Kinetic information
Michaelis-Menten [Pubmed|6414463]
Paralogous protein(s)
[protein|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB], [protein|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]-[gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]-[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]-[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]
description
[Pubmed|11976308]
regulation
''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20081037], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]→[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]

2024-05-22 00:31:42

ghost

74

797fea7dcbe4317f63eb94d44165272d12ff3ae4

3D5EA61F84C1F6538A394D4F9A00FD4029ED115F

Biological materials
Mutant
GP459 (spc), available in [wiki|Jrg Stlke]'s lab
BKE14590 ([gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATTGTCATTTGCGCCA, downstream forward: _UP4_TAATCAAACTGCATAATCGA
BKK14590 ([gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATTGTCATTTGCGCCA, downstream forward: _UP4_TAATCAAACTGCATAATCGA
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
lacZ fusion
pGP722 (in [wiki|pAC5]), available in [wiki|Jrg Stlke]'s lab
labs
[wiki|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
References
Reviews
19476487,9655937,2227213,6805383,24798336
Original Publications
9352926,15378759,12850135,17218307,18763711,6414463,11976308,28189581,36815589,37777474

458E967052D1093A0F48AE0E6B6CCA0F52EAC44D

Page visits: 3686

Time of last update: 2024-05-23 02:27:23

Author of last update: Christoph.elfmann