


Molecular weight
24.21 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

569,290  569,949
Visit Sartorius.com Visit Sartorius.com
The protein
cell membrane (according to UniProt)
Expression and Regulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab


2024-05-12 00:01:49





Biological materials
MGNA-C133 (ydeJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2131 NBRP B. subtilis, Japan]
BKE05220 ([gene|45438A54D3B3D6F1781CB86BB6E78FB088DBAF97|ydeJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATTCCTCTCTA,  downstream forward: _UP4_TAATCAGTATTCGTTTGTCT
BKK05220 ([gene|45438A54D3B3D6F1781CB86BB6E78FB088DBAF97|ydeJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATTCCTCTCTA,  downstream forward: _UP4_TAATCAGTATTCGTTTGTCT


Page visits: 1557

Time of last update: 2024-05-25 08:57:37

Author of last update: Melvin.boenninger