ytsJ

ytsJ
168

bifunctional malic/malolactic enzyme

locus
BSU_29220
Molecular weight
43.51 kDa
pI
5.05
Protein length
Gene length
function
malate utilization, balancing of the NADPH pool
product
bifunctional malic/malolactic enzyme
essential
no
ec
1.1.1.38
synonyms
ytsJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0281 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,989,900 2,991,132
Phenotypes of a mutant
Poor growth with malate as single carbon source [Pubmed|16788182]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(S)-malate + NADP+ --> CO2 + NADPH + pyruvate [pubmed|33824210]
malate --> lactate + CO2 [pubmed|33824210]
Protein family
[wiki|malic enzymes family] (according to UniProt)
[wiki|Cofactors]
NADP+
Structure
[PDB|1WW8] (from ''Pyrococcus horikoshii'', 46% identity, 63% similarity)
[AF|O34962]
Modification
phosphorylated on Arg-27 [Pubmed|31221751]
Effectors of protein activity
in the presence of excess NADPH, the enzyme switches from oxidative pyruvate formation to non-oxidative lactate formation [pubmed|33824210]
Paralogous protein(s)
[protein|BBBCD5F56779895189E21076AF165B901F654534|malS], [protein|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]
[wiki|Localization]
Cytoplasm (Homogeneous) [Pubmed|16479537]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]
description
[Pubmed|9387221]
Open in new tab

[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]

2024-05-14 10:07:46

ghost

80

c76280c63d73af3c4e93f4b73f3fb7abab784b58

F8528F440486BCBD01D9FB7632E3FE592F580EBB

genes
[gene|65B5EA4DBDF5B260DED754B8A7B226AA88F17B55|dnaE]-[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]
description
[pubmed|22383849]
regulation
induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14593098,16267290 PubMed]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [PubMed|14593098,16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab

[gene|65B5EA4DBDF5B260DED754B8A7B226AA88F17B55|dnaE]→[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]

2024-05-16 03:22:57

Jstuelk

109

5807e5e50bd25f38dbc805171d3f14f5354cd973

F93681166D0A46D0BAA5D0678231F87A3D3BB25B

Biological materials
Mutant
MGNA-A176 (ytsJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/176 NBRP B. subtilis, Japan]
GP612 (spc), available in [wiki|Jrg Stlke]'s lab
GP1143 (spc), available in [wiki|Jrg Stlke]'s lab
BKE29220 ([gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
BKK29220 ([gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
FLAG-tag construct
GP1131 (spc, based on [wiki|pGP1331]), available in [wiki|Jrg Stlke]'s lab [pubmed|20933603]
GFP fusion
GP1432 (spc, based on [wiki|pGP1870]), available in [wiki|Jrg Stlke]'s lab
labs
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
16479537,16788182,12949160,9387221,23136871,22740702,15378759,31221751,33824210

45229A538D5124B60CE05DDC8699B9BC3D5AD9FF

Page visits: 5254

Time of last update: 2024-05-23 02:04:25

Author of last update: Jstuelk