

phosphoribosylaminoimidazole succinocarboxamide synthase

Molecular weight
27.31 kDa
Protein length
Gene length
purine biosynthesis
phosphoribosylaminoimidazole succinocarboxamide synthase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0152 (Galperin et al., 2021)

This gene is a member of the following regulons

701,601 702,326
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate + ATP + L-aspartate --> (2S)-2-[5-amino-1-(5-phospho--D-ribosyl)imidazole-4-carboxamido]succinate + ADP + 2 H+ + phosphate (according to UniProt)
Protein family
SAICAR synthetase family (according to Swiss-Prot)
[PDB|1KUT] (from ''Thermotoga maritima'', 40% identity, 57% similarity) [Pubmed|16582479]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
expression activated by glucose (4.4 fold) [Pubmed|12850135]
regulatory mechanism
G-box: RNA switch, ([wiki|riboswitch]) [pubmed|3036807,12787499], in [regulon|other_regulator:G-box|G-box]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3036807], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-05-22 00:19:03





Biological materials
BKE06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT
BKK06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT


Page visits: 4469

Time of last update: 2024-05-23 02:06:38

Author of last update: Melvin.boenninger