yhdK

yhdK
168

anti-[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] factor, with [protein|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL], responds to the free pool of the carrier lipid undecaprenyl-phosphate

locus
BSU_09500
Molecular weight
10.50 kDa
pI
8.13
Protein length
Gene length
function
control of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] activity
product
anti-[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] protein
essential
no
synonyms
yhdK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,028,233  1,028,523
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
small colonies on LB [pubmed|30715747]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[AF|O07580]
[wiki|Localization]
cell membrane [Pubmed|14993308]
Expression and Regulation
Operons
genes
[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]-[gene|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL]-[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]
description
[Pubmed|9573210]
regulation
induced by glucose [Pubmed|27965645]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9573210], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|9573210,18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
additional information
expression of [protein|search|CsbB] in the absence of [protein|search|YfhO] causes constitutive activation of [protein|search|SigM] [PubMed|23632331]
Open in new tab

[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]→[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]

2024-05-30 13:44:37

ghost

97

fb4e4633900f4ef286077c42a3c137436842759c

3F70EAF5AFE9E64A7150341483663D9A7347A835

Biological materials
Mutant
MGNA-A694 (yhdK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/694 NBRP B. subtilis, Japan]
BP97 (Δ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]-[gene|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL]-[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK])::aphA3), available in [wiki|Fabian Commichau]'s lab
BKE09500 ([gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TACATTGTGTTCTTTAAAAA,  downstream forward: _UP4_TAAAAAAGACGCCTTTTCAG
BKK09500 ([gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TACATTGTGTTCTTTAAAAA,  downstream forward: _UP4_TAAAAAAGACGCCTTTTCAG
References
Reviews
27344142,29343670
Original Publications
18179421,14993308,9573210,30715747,38683856

43AD66E4AEE951130F134FD720E17DB4D2FF112E

Page visits: 2689

Time of last update: 2024-06-18 19:12:37

Author of last update: Jstuelk