

2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase

Molecular weight
27.34 kDa
Protein length
Gene length
biosynthesis of the siderophore bacillibactin
2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
dhbA, entA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028 (Galperin et al., 2021)

This gene is a member of the following regulons

3,291,511  3,292,296
Phenotypes of a mutant
defective in biofilm formation, this can be suppressed by the addition of 2,3-dihydroxybenzoate to the medium [pubmed|31420537]
defective in sporulation timing [pubmed|34460312]
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
(2S,3S)-2,3-dihydroxy-2,3-dihydrobenzoate + NAD+ --> 2,3-dihydroxybenzoate + H+ + NADH (according to UniProt)
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
[PDB|2FWM] (from E. coli, 42% identity) [pubmed|16790929]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,12354229]
expression is increased in the presence of pulchimerrin [pubmed|37137890]
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]: repression, in [regulon|protein:65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8550523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [pubmed|29914988], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
additional information
the ''[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]'' operon is strongly unregulated in a ''[wiki|kre]'' mutant [Pubmed|26110430]
Open in new tab


2024-07-06 03:46:06





Biological materials
BKE32000 ([gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATCAATTCCTTTCT,  downstream forward: _UP4_TAACTGAATTTAAAGGAGGT
BKK32000 ([gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATCAATTCCTTTCT,  downstream forward: _UP4_TAACTGAATTTAAAGGAGGT
lacZ fusion
pGP3594 (based on [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab


Page visits: 7431

Time of last update: 2024-07-14 16:34:18

Author of last update: Jstuelk