hutM

hutM
168

histidine permease

locus
BSU_39390
Molecular weight
51.41 kDa
pI
9.01
Protein length
Gene length
function
histidine uptake
product
histidine permease
essential
no
synonyms
hutM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0833 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,047,538  4,048,965
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|7CMH] (human protein, corresponds to aa 23 ... 356, 25% identity) [pubmed|33298890]
[AF|P42087]
Paralogous protein(s)
[protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|aimB], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|alaP]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
description
[Pubmed|10746760]
regulation
induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8071225], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8682780], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]: antitermination, at a protein-dependent [wiki|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|protein:BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8071225], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]→[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]

2024-07-09 18:58:13

ghost

112

cf3eb91928f3fe61cbc0cd204535c4f9c144314a

0AE45FCE38B0E774CFFC5F6A0A98EEDF6B02F4D4

Biological materials
Mutant
GP3609 (phleo), available in [wiki|Jörg Stülke]'s lab
MGNA-B783 (hutM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1782 NBRP B. subtilis, Japan]
BKE39390 ([gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTCGCCCTCCTTTT,  downstream forward: _UP4_TAATTAAAAAAGCACACCCC
BKK39390 ([gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTCGCCCTCCTTTT,  downstream forward: _UP4_TAATTAAAAAAGCACACCCC
References
Reviews
22933560
Original Publications
10746760,8071225,8682780,10217782,33298890

423AEC9D260BE53AD22851D999244B89BEB3E84D

Page visits: 3275

Time of last update: 2024-07-15 00:46:42

Author of last update: Jstuelk