

bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase

Molecular weight
67.75 kDa
Protein length
Gene length
methionine biosynthesis, tetrahydrofolate interconversion
bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0685 (Galperin et al., 2021)

This gene is a member of the following regulons

1,178,757  1,180,595
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
S-methyl-L-methionine + L-homocysteine --> 2 L-methionine (according to UniProt)
5-methyltetrahydrofolate + NAD(P)+ --> 5,10-methylenetetrahydrofolate + NAD(P)H (according to UniProt)
Protein family
C-terminal part: methylenetetrahydrofolate reductase family (single member, according to UniProt)
Hcy-binding domain (aa 1-280) (according to UniProt)
FAD (according to UniProt)
Zn2+ (according to UniProt)
[PDB|1Q7M] (the methionine synthase domain, from Thermotoga maritima, 31% identity) [pubmed|14752199]
[PDB|6FNU] (the methylene THF reductase domain, from Saccharomyces cerevisiae, 25% identity)
membrane associated [Pubmed|18763711]
Expression and Regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, [pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
Open in new tab


2024-06-20 04:54:58





Biological materials
MGNA-B195 (yitJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1194 NBRP B. subtilis, Japan]
BKE11010 ([gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTGCCTCCTTTATT,  downstream forward: _UP4_TAATTTCCAAAAGACTGCCT
BKK11010 ([gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTGCCTCCTTTATT,  downstream forward: _UP4_TAATTTCCAAAAGACTGCCT
Other publications
The [[protein|S-box]]


Page visits: 3055

Time of last update: 2024-06-22 15:16:57

Author of last update: Jstuelk