yfnF

yfnF
168

unknown

locus
BSU_07290
Molecular weight
34.87 kDa
pI
4.67
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfnF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
800,232  801,143
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[AF|O06484]
Expression and Regulation
Operons
genes
[gene|B25AE6979AF12628780C4489FFED966C6B31968A|yfnH]-[gene|9836E90BD443F5269A43E5C69FCF2CCB22EDF65B|yfnG]-[gene|4148A3F8E256D9B1D667C28428D867B5B6B5F3CE|yfnF]-[gene|E3481379D3FEC02C35CB4BE17A5246A208C5C86D|yfnE]-[gene|1D0286ECDA32FB21737170B54A57D3FE482C6422|yfnD]
description
[Pubmed|22383849]
regulation
expressed during sporulation ([protein|search|SigK]) [Pubmed|15383836]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|26577401], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15383836], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, internal promoter in [protein|E3481379D3FEC02C35CB4BE17A5246A208C5C86D|yfnE] open reading frame [Pubmed|15383836], see [http://dbtbs.hgc.jp/COG/prom/yfnHGFED.html DBTBS] for details, in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|B25AE6979AF12628780C4489FFED966C6B31968A|yfnH]→[gene|1D0286ECDA32FB21737170B54A57D3FE482C6422|yfnD]

2024-06-19 22:56:30

ghost

75

0c2ff262cf65580a1faaadb4e41f48ec944f3022

1D656EAE328F52D0DE485D0C416B05C0B1DB28D2

Biological materials
Mutant
MGNA-C228 (yfnF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2226 NBRP B. subtilis, Japan]
BKE07290 ([gene|4148A3F8E256D9B1D667C28428D867B5B6B5F3CE|yfnF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGTCTTGTTCACCTCGT,  downstream forward: _UP4_TAAATGAGTAAATACAGGAA
BKK07290 ([gene|4148A3F8E256D9B1D667C28428D867B5B6B5F3CE|yfnF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGTCTTGTTCACCTCGT,  downstream forward: _UP4_TAAATGAGTAAATACAGGAA
References
15383836,26577401

4148A3F8E256D9B1D667C28428D867B5B6B5F3CE

Page visits: 2072

Time of last update: 2024-06-21 01:33:03

Author of last update: Bzhu