opuBA

opuBA
168

choline and arsenocholine ABC transporter (ATP-binding protein)

Locus
BSU_33730
Molecular weight
42.92 kDa
Isoelectric point
5.65
Protein length
Gene length
Function
compatible solute transport
Product
choline and arsenocholine ABC transporter (ATP-binding protein)
Essential
no
Synonyms
opuBA, proV

Genomic Context

List of homologs in different organisms, belongs to COG1125 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, GbsR regulon, OpcR regulon, RemA regulon

Gene
Coordinates
3,462,105  3,463,250
The protein
Catalyzed reaction/ biological activity
uptake of choline and arsenocholine PubMed
Protein family
ABC transporter superfamily (according to UniProt)
2 CBS domains (aa 256-314, aa 316-374) (according to UniProt)
ABC transporter domain (aa 2-236) (according to UniProt)
Structure
2IT1 (PDB) (from Pyrococcus horikoshii, 43% identity)
Paralogous protein(s)
associated to the membrane (via OpuBB-OpuBD) PubMed
Expression and Regulation
Operons
Description
Regulation
induced by choline (GbsR) PubMed
Regulatory mechanism
GbsR: repression, (transcriptional roadblock) PubMed, in gbsR regulon
OpcR: repression, (sterical interference with RNA polymerase access) PubMed, in opcR regulon
RemA: activation, PubMed, in remA regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
An antisense RNA is predicted for'opuBD' PubMed
Open in new tab

opuBAopuBD

2025-04-03 13:33:40

ghost

91

f5d474616565c5e32550f1c34aef09f972669a8e

1F7D81939583251B3B9B9F3D0D915C77CF89D428

Biological materials
Mutant
BKE33730 (opuBA::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAACATCGCACCTCCAAAA,  downstream forward: _UP4_TAGGGAGGGGCGATAAGTCA
BKK33730 (opuBA::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAACATCGCACCTCCAAAA,  downstream forward: _UP4_TAGGGAGGGGCGATAAGTCA
Expression vectors
pGP2938: (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
pGP3013: (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
LacZ fusion
pGP3880 (kan, based on pAC7]), available in Jörg Stülke's lab
GP4303 (opuBA-lacZ::aphA3), available in Jörg Stülke's lab
References
Reviews
Loading
Original Publications
Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
Warmbold B, Ronzheimer S, Freibert SA, Seubert A, Hoffmann T, Bremer ETwo MarR-Type Repressors Balance Precursor Uptake and Glycine Betaine Synthesis in Bacillus subtilis to Provide Cytoprotection Against Sustained Osmotic Stress.Frontiers in microbiology. 2020; 11:1700. PMID: 32849357
Rath H, Reder A, Hoffmann T, Hammer E, Seubert A, Bremer E, Völker U, Mäder U Management of Osmoprotectant Uptake Hierarchy in via a SigB-Dependent Antisense RNA. Frontiers in microbiology. 2020; 11:622. doi:10.3389/fmicb.2020.00622. PMID:32373088
Hoffmann T, Warmbold B, Smits SHJ, Tschapek B, Ronzheimer S, Bashir A, Chen C, Rolbetzki A, Pittelkow M, Jebbar M, Seubert A, Schmitt L, Bremer E Arsenobetaine: an ecophysiologically important organoarsenical confers cytoprotection against osmotic stress and growth temperature extremes. Environmental microbiology. 2017 Nov 21; . doi:10.1111/1462-2920.13999. PMID:29159878
Lee CH, Wu TY, Shaw GC Involvement of OpcR, a GbsR-type transcriptional regulator, in negative regulation of two evolutionarily closely related choline uptake genes in Bacillus subtilis. Microbiology (Reading, England). 2013 Oct; 159(Pt 10):2087-96. doi:10.1099/mic.0.067074-0. PMID:23960087
Winkelman JT, Bree AC, Bate AR, Eichenberger P, Gourse RL, Kearns DB RemA is a DNA-binding protein that activates biofilm matrix gene expression in Bacillus subtilis. Molecular microbiology. 2013 Jun; 88(5):984-97. doi:10.1111/mmi.12235. PMID:23646920
Nau-Wagner G, Opper D, Rolbetzki A, Boch J, Kempf B, Hoffmann T, Bremer E Genetic control of osmoadaptive glycine betaine synthesis in Bacillus subtilis through the choline-sensing and glycine betaine-responsive GbsR repressor. Journal of bacteriology. 2012 May; 194(10):2703-14. doi:10.1128/JB.06642-11. PMID:22408163
Hoffmann T, Bremer E Protection of Bacillus subtilis against cold stress via compatible-solute acquisition. Journal of bacteriology. 2011 Apr; 193(7):1552-62. doi:10.1128/JB.01319-10. PMID:21296969
Kappes RM, Kempf B, Kneip S, Boch J, Gade J, Meier-Wagner J, Bremer E Two evolutionarily closely related ABC transporters mediate the uptake of choline for synthesis of the osmoprotectant glycine betaine in Bacillus subtilis. Molecular microbiology. 1999 Apr; 32(1):203-16. . PMID:10216873
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453
Nau-Wagner G, Boch J, Le Good JA , Bremer E High-affinity transport of choline-O-sulfate and its use as a compatible solute in Bacillus subtilis. Applied and environmental microbiology. 1999 Feb; 65(2):560-8. . PMID:9925583

3F502A4DCB1DAD7C3F968465B13C35213240515B

Page visits: 4221

Time of last update: 2025-04-08 05:02:49

Author of last update: Jstuelk