mrfB

mrfB
168

Mg2+-dependent 3'-5' DNA exonuclease, part of a novel nucleotide excision repair pathway (with [protein|4D286C045A43FBF0F6E93E9E46AD7F25E35ADA7C|mrfA])

locus
BSU_22210
Molecular weight
47.83 kDa
pI
7.16
Protein length
Gene length
function
mitomycin C-specific DNA damage repair
product
metal-dependent DNA exonuclease
essential
no
synonyms
mrfB, yprB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3359 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,333,324  2,334,565
Phenotypes of a mutant
sensitive to mitomycin C [pubmed|30379365]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
repair of mitomycin C-induced DNA adducts [pubmed|38661211]
[wiki|Cofactors]
Mg2+ [pubmed|30379365]
Structure
[PDB|8UN9] [pubmed|38661211]
[AF|P50837]
Expression and Regulation
Operons
genes
[gene|4D286C045A43FBF0F6E93E9E46AD7F25E35ADA7C|mrfA]-[gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]-[gene|FA8D9AA0968365522DEFC05B277123FC96482044|cotD]
description
[Pubmed|22383849]
Open in new tab

[gene|4D286C045A43FBF0F6E93E9E46AD7F25E35ADA7C|mrfA]→[gene|FA8D9AA0968365522DEFC05B277123FC96482044|cotD]

2024-05-21 04:11:40

Jstuelk

43

14a2bf6c0f2fb4d70fe21c4e69da61c2a7c1ca91

729017EE549CDEA9A9C262C8E1D54EEDD385E33D

Biological materials
Mutant
MGNA-A413 (yprB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/413 NBRP B. subtilis, Japan]
BKE22210 ([gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAATGACATATCCGGCCTCC,  downstream forward: _UP4_TAAATATTCCCCGGGAAAGC
BKK22210 ([gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAATGACATATCCGGCCTCC,  downstream forward: _UP4_TAAATATTCCCCGGGAAAGC
References
Reviews
35210609
Research papers
30379365,38661211

3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852

Page visits: 1387

Time of last update: 2024-06-21 01:08:48

Author of last update: Jstuelk