ribD

ribD
168

5-amino-6-(5-phosphoribosylamino)uracil reductase

locus
BSU_23280
Molecular weight
39.15 kDa
pI
6.08
Protein length
Gene length
function
riboflavin biosynthesis
product
5-amino-6-(5-phosphoribosylamino)uracil reductase
essential
no
ec
3.5.4.26
synonyms
ribD, ribG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1985 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,430,258  2,431,343
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
2,5-diamino-6-hydroxy-4-(5-phosphoribosylamino)-pyrimidine + H+ + H2O --> 5-amino-6-(5-phospho-D-ribosylamino)uracil + NH4+ (according to UniProt)
5-amino-6-(5-phospho-D-ribitylamino)uracil + NADP+ --> 5-amino-6-(5-phospho-D-ribosylamino)uracil + H+ + NADPH (according to UniProt)
Protein family
N-terminal part: [wiki|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
C-terminal part: HTP reductase family (single member, according to UniProt)
[wiki|Domains]
[wiki|CMP/dCMP-type deaminase domain] (aa 1–122) (according to UniProt)
Structure
[PDB|3EX8] [Pubmed|18986985]
[AF|P17618]
[wiki|Localization]
cytoplasm [pubmed|34474681]
Expression and Regulation
Operons
genes
[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
description
[Pubmed|8159171]
regulation
expressed in the absence of FMN ([wiki|FMN-box]) [Pubmed|15808508]
binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR] to the [wiki|FMN-box] riboswitch can enforce expression even in the presence of FMN [pubmed|26494285]
the [wiki|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
FMN-box: RNA switch, via [wiki|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR], in [regulon|other_regulator:FMN-box|FMN-box]
[protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]: antitermination, [pubmed|26494285], in [regulon|protein:3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8159171], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]→[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]

2024-06-08 12:44:39

Jstuelk

99

3D660447137821317811200D29A5FC04A41E938E

05C8A4E892E7DB3D953FE72E8765638644759326

Biological materials
Mutant
BKE23280 ([gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCCCTCCCCTCT,  downstream forward: _UP4_CCGACAAAGGAATAGGATGG
BKK23280 ([gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCCCTCCCCTCT,  downstream forward: _UP4_CCGACAAAGGAATAGGATGG
References
12456892,15808508,18986985,8159171,7934830,23270261,26494285,29794222,29864427,32817529,34474681

3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180

Page visits: 2822

Time of last update: 2024-06-23 12:08:45

Author of last update: Jstuelk