

riboflavin kinase with preference for dihydroriboflavin, binds FMN riboswitches of the rib operon and of ribU to allow expression even in the presence of FMN, required for the conversion of S-methyl-cysteine to cysteine

Molecular weight
26.08 kDa
Protein length
Gene length
utilization of S-methyl-cysteine, regulation of rib operon expression
riboflavin kinase with preference for dihydroriboflavin
ribR, ytnK, rbfK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0196 (Galperin et al., 2021)

This gene is a member of the following regulons

3,000,985  3,001,677
Phenotypes of a mutant
no growth with S-methyl cysteine [Pubmed|23944997]
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
synthesis of FMNH2 [Pubmed|26494285]
binds the [wiki|FMN riboswitch] [Pubmed|26494285]
prevents transcription termination of the ''[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]'' operon even in the presence of FMN or FMNH2 [Pubmed|26494285]
prevents sequestration of the ribosome binding site of the ''[gene|651C370386E9FB45E3B98001800D342FEDB43E9A|ribU]'' mRNA even in the presence of FMN or FMNH2 [Pubmed|26494285]
ATP + riboflavin --> ADP + FMN + H+ (according to UniProt)
Protein family
RibR family (single member, according to UniProt)
Paralogous protein(s)
[protein|85E732993186528CF58FECFFE89C8F39D278F28D|ribC], (42%)
Expression and Regulation
induced in the presence of methionine and taurine [Pubmed|11390694]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, [Pubmed|16109943], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
[protein|741156D495BE3857683C8A0390764EAD83845ABC|ascR]: activation, [Pubmed|16109943], in [regulon|protein:741156D495BE3857683C8A0390764EAD83845ABC|ascR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15272571], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-01 00:51:28





Biological materials
MGNA-A154 (ribR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/154 NBRP B. subtilis, Japan]
BKE29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT,  downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
BKK29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT,  downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA


Page visits: 6310

Time of last update: 2024-06-23 03:17:30

Author of last update: Melvin.boenninger