sigE

sigE
168

[wiki|RNA polymerase ][wiki|sporulation ]mother cell-specific (early) [wiki|sigma factor ]SigE

locus
BSU_15320
Molecular weight
27.55 kDa
pI
9.21
Protein length
Gene length
function
transcription of [wiki|sporulation ]genes (early mother cell)
product
[wiki|RNA polymerase ][wiki|sporulation ]mother cell-specific (early) [wiki|sigma factor ]SigE
essential
no
synonyms
sigE, spoIIGB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5811 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,604,771  1,605,490
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[wiki|RNA polymerase] [wiki|sigma factor], active in the mother cell
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
Structure
[PDB|8B3Z] (aa 17 ... 133) [pubmed|37110501]
[PDB|1L0O] ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] in complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], Geobacillus stearothermophilus, 33% identity) [pubmed|11955433]
[AF|P06222]
Expression and Regulation
Operons
genes
[gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]-[gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]-[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
description
[Pubmed|1902213]
regulation
''[wiki|spoIIGA]'': expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8288522,15687200 PubMed]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|8288522,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2512576], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1902213], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
additional information
the mRNA half-life is about 2.6 min [PubMed|24163345]
Open in new tab

[gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]→[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]

2024-07-03 23:53:19

ghost

110

3354b759a5d3c11fb5b0d40216c1a7e1d8249a30

020EF37B0706DBB0AF1DC411F77E0B6D94001319

additional information
[protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Biological materials
Mutant
BKE15320 ([gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCCTCTCCCTTCTAA,  downstream forward: _UP4_TAAAAAATTTTATGGTTAGA
BKK15320 ([gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCCTCTCCCTTCTAA,  downstream forward: _UP4_TAAAAAATTTTATGGTTAGA
labs
[wiki|Bill Haldenwang], San Antonio, USA
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
References
Reviews
20833318,31350897,35638784
Original Publications
7768847,8002606,8449878,10438769,9922240,10869437,13129963,7585939,1729246,9244279,11849534,8231808,8171000,15547282,15882622,9537362,1542693,1946462,8550479,10498732,15978076,9006059,2115864,7473719,12644503,2115871,15028683,7601832,9150232,1624450,1744037,1400231,2495274,11886548,2514119,1744038,14523132,18436644,8288522,15687200,25835496,23169620,21362630,20802044,21478340,11955433,37110501
The [wiki|SigE regulon]
12662922,15383836,14523133

3CB24D493B3282278B7DC61CE3C793DFA815F9E2

Page visits: 9475

Time of last update: 2024-07-15 04:09:12

Author of last update: Jstuelk