
Molecular weight
12.85 kDa
Protein length
Gene length
control of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] activity

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5815 (Galperin et al., 2021)

This gene is a member of the following regulons

2,444,645  2,444,998
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
anti-sigma-factor antagonist family (with [protein|AC64DA463250A090A62E50901EFE653C8F963872|rsbV], according to UniProt)
[wiki|STAS domain] (aa 3-113) (according to UniProt)
[PDB|1TIL] (complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], Geobacillus stearothermophilus) [pubmed|15236958]
phosphorylation on (Ser-58 OR Ser-59) by [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB][Pubmed|17218307], [Pubmed|16493705]
Expression and Regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|1556084,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab


2024-07-03 09:04:04





''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2024-07-04 03:41:30





Biological materials
BKE23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT,  downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
BKK23470 ([gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCCTCCTTGAT,  downstream forward: _UP4_CTCCTGACACTGGGGGTGGC
[wiki|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html homepage]
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
Original Publications


Page visits: 5037

Time of last update: 2024-07-16 06:35:52

Author of last update: Christoph.elfmann