glpP

glpP
168

transcriptional antiterminator of the [gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]-[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ] and [gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]-[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]-[gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD] operons

locus
BSU_09270
Molecular weight
21.46 kDa
pI
8.1
Protein length
Gene length
function
regulation of glycerol and glycerol-3-phosphate utilization
product
transcriptional antiterminator
essential
no
synonyms
glpP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1954 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,001,744  1,002,322
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[PDB|3KTS] (from Listeria monocytogenes, 49% identity)
[AF|P30300]
Expression and Regulation
Operons
genes
[gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]-[gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]
description
[Pubmed|2127799]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21925382], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
half-life of the mRNA: 3.7 min [PubMed|21925382]
half-life of the mRNA: 3.7 min [PubMed|21925382]
Open in new tab

[gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]→[gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]

2024-07-04 03:43:56

ghost

45

85fa23eb85aa1c06a9e72b2b9b163d1ad44292f2

47E1A440F693CB9BD8DD6A418F32F7921D2D6BFD

Biological materials
Mutant
BKE09270 ([gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGCTCCTTTAATAATT,  downstream forward: _UP4_TGACACCGCTTTCATGCACT
BKK09270 ([gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGCTCCTTTAATAATT,  downstream forward: _UP4_TGACACCGCTTTCATGCACT
labs
[wiki|Josef Deutscher], Paris-Grignon, France
References
8825777,11929549,8436953,9595668,9493382,1479885,1809833,182672,21925382

38767691AE7E09F46B9E97A60BF5358C1876EDF8

Page visits: 4772

Time of last update: 2024-07-15 05:02:52

Author of last update: Jstuelk