spoVS

spoVS
168

required for dehydratation of the spore core and assembly of the coat, mutation increases [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-dependent gene expression, might act via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]

locus
BSU_16980
Molecular weight
8.66 kDa
pI
6.47
Protein length
Gene length
function
spore coat assembly, spore core dehydratation
product
unknown
essential
no
synonyms
spoVS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2359 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,769,935  1,770,195
Phenotypes of a mutant
increased [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-dependent gene expression, this might occur via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] [Pubmed|16428420]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[PDB|2EK0] (from ''Thermus thermophilus'', 56% identity)
[AF|P45693]
Expression and Regulation
Operons
genes
[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]
description
[Pubmed|7559352]
regulation
expressed at the onset of stationary phase ([protein|search|SigH]) [Pubmed|7559352]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|7559352], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]

2024-07-04 05:26:08

ghost

45

1d4885d1b007956fc54723814ce894044e21b368

A888D52466DF0016FB8B7E8162D14F281A6E091F

Biological materials
Mutant
GP1601 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::cat), available in [wiki|Jörg Stülke]'s lab
GP1848 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [wiki|Jörg Stülke]'s lab
BKE16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT,  downstream forward: _UP4_TAAAAACAAATAAAGCATTC
BKK16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT,  downstream forward: _UP4_TAAAAACAAATAAAGCATTC
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
7559352,18562273,16428420,20525796,35638784

384D4D4C58FCBEB46B762E01478F4081FC6FAE4A

Page visits: 3633

Time of last update: 2024-07-13 22:05:32

Author of last update: Jstuelk