bdhA

bdhA
168

acetoine/ butanediol dehydrogenase

locus
BSU_06240
Molecular weight
37.19 kDa
pI
4.8
Protein length
Gene length
function
overflow metabolism, fermentation
product
acetoine/ butanediol dehydrogenase
essential
no
ec
1.1.1.76
synonyms
bdhA, ydjL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1063 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
677,911 678,951
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
formation of butanediol from acetoin [Pubmed|18820069]
(R,R)-butane-2,3-diol + NAD+ --> (R)-acetoin + H+ + NADH (according to UniProt)
Protein family
[wiki|zinc-containing alcohol dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
NAD+ (according to UniProt)
Structure
[PDB|6IE0]
[AF|O34788]
Modification
phosphorylated on Arg-13 [Pubmed|22517742]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]
description
[Pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]

2024-05-19 08:10:14

Jstuelk

51

db038c4399da9190e64195a4a2f1acef5062de1a

AD4F86B3F3FD5084F3C02020684E1A61FE1F105B

Biological materials
Mutant
MGNA-C219 (ydjL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2217 NBRP B. subtilis, Japan]
BKE06240 ([gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGATTACCACTCCTATA, downstream forward: _UP4_TAATTTGAAACCAAAAAGAA
BKK06240 ([gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGATTACCACTCCTATA, downstream forward: _UP4_TAATTTGAAACCAAAAAGAA
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
References
18820069,22361854,22517742,22178965,20817675,23576037,15378759,24608678,26385762,26825987,28426331,29512378,36781054,36815589

37A9CD057DC311397B9A5757F6ED7AE6998F6D5D

Page visits: 5857

Time of last update: 2024-05-23 06:50:14

Author of last update: Jstuelk