yoaD

yoaD
168

similar to phosphoglycerate dehydrogenase

locus
BSU_18560
Molecular weight
38.47 kDa
pI
5.62
Protein length
Gene length
function
methionine biosynthesis
product
unknown
essential
no
synonyms
yoaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0111 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,024,042  2,025,076
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
YoaD is likely to convert 3-phosphoglycerate to serine for use in methionine biosynthesis (based on [protein|search|S-box] regulation)
Protein family
D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT] and [protein|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA], according to UniProt)
Structure
[PDB|1WWK] (phosphoglycerate dehydrogenase from Pyrococcus horikoshii, 35% identity)
[AF|O34815]
Additional information
The gene is annotated in KEGG as an ortholog of D-3-phosphoglycerate dehydrogenase EC 1.1.1.95. No EC annotation is available in Swiss-Prot. In MetaCyc the protein is marked as similar to phosphorglycerate dehydrogenase. No literature/experimental evidence supporting the annotation is available.  [Pubmed|19935659]
Expression and Regulation
Operons
genes
[gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]-[gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]-[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]
description
[Pubmed|10094622]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
Open in new tab

[gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]→[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]

2024-06-18 00:48:49

Jstuelk

68

0b52fbe0bb9d5809477459667c1400f3004ff193

D97B471EE690CF8F0B0DBE37D2272E2DA13A7F83

Biological materials
Mutant
MGNA-A835 (yoaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/835 NBRP B. subtilis, Japan]
BKE18560 ([gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC,  downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA
BKK18560 ([gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC,  downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA
References
19258532,10094622,12107147,18039762,29794222

3769B79A180412C0FE98B3FC54BA49750BAFEDF6

Page visits: 3506

Time of last update: 2024-06-21 19:48:43

Author of last update: Melvin.boenninger