mtnB

mtnB
168

methylthioribulose-1-phosphate dehydratase

locus
BSU_13610
Molecular weight
23.34 kDa
pI
5.69
Protein length
Gene length
function
methionine salvage
product
methylthioribulose-1-phosphate dehydratase
essential
no
ec
4.2.1.109
synonyms
mtnB, ykrY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0235 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,428,940  1,429,569
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
5-methylsulfanyl-D-ribulose 1-phosphate --> 5-methylsulfanyl-2,3-dioxopentyl phosphate + H2O (according to UniProt)
Protein family
aldolase class II family (with [protein|3859854178E573AE8ACCE6DF85E32C495D316DA1|araD], according to UniProt)
Structure
[PDB|2IRP] (from Aquifex aeolicus, 40% identity)
[AF|O31668]
Expression and Regulation
Operons
genes
[gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]-[gene|91633E6AF9A715166AE05BD7E540463DE352AA20|mtnX]-[gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]-[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]
description
[Pubmed|12022921]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12022921], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]→[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]

2024-06-20 06:43:32

Jstuelk

57

a2b13ba83890892f9d8595d5e452be227045e93c

6416B0A5CDDC144986D3159AFC5B04D4507F2AE1

Biological materials
Mutant
MGNA-B322 (ykrY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1321 NBRP B. subtilis, Japan]
BKE13610 ([gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCTCTCTCTGCCAATTCCC,  downstream forward: _UP4_GTTAAATAAAAGGAGGAATT
BKK13610 ([gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCTCTCTCTGCCAATTCCC,  downstream forward: _UP4_GTTAAATAAAAGGAGGAATT
References
12022921,11914366,12107147,15102328,12787499,18039762,28516784

337F1E27C2E380DF8DCADE3581F74CFF52AFD224

Page visits: 3537

Time of last update: 2024-06-21 20:12:08

Author of last update: Melvin.boenninger